معلومة

إيجاد الحمض النووي من مشكلة تسلسل الأحماض الأمينية

إيجاد الحمض النووي من مشكلة تسلسل الأحماض الأمينية



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

محاولتي: أولاً أخذت أكواد AA ذات الحرف الواحد وجعلتها أحماض أمينية. إذن ، أول واحد هو Trp وهو 5'-UGG-3 '. من هذا حصلت على تسلسل الحمض النووي 3'-CCA-5 '. ومع ذلك ، فإن الإجابة الصحيحة (الموضحة باللون الأحمر) لا تحتوي على هذا التسلسل. أي خطأ ارتكبت؟


كان نهجك لترجمة تسلسل AA ، codon by codon ، صحيحًا. كان هذا سؤالًا خادعًا بعض الشيء لأنه للتعرف عليه ، كان عليك قراءة التسلسل بالعكس.

تتم قراءة UGG-CAA-GGT-CAC إلخ مباشرة من الخيط 3 '-> 5' للإجابة المحاطة بدائرة ، القراءة من اليمين إلى اليسار.

أسفل اليسار عبارة عن رنجة حمراء لأنها تبدأ برمز البداية ، ATG ، لكن القراءة بعد كود البداية ، لن تتطابق التسلسل.


ترجمة mRNA إلى الأحماض الأمينية المقابلة.

يقوم mRNA بنسخ الحمض النووي. هذا يعني أنه يحمل معلومات أو تعليمات الحمض النووي التي تحدد البروتين الذي يجب إنتاجه. وهذا هو سبب تسميته بالرسول RNA لأنه يوصل الرسالة إلى موقع إنتاج البروتين ، الريبوسومات.

يُعرف الحمض الريبي النووي النقال أيضًا باسم نقل الحمض النووي الريبي. ينقل الأحماض الأمينية إلى قالب mRNA. يعمل كمحول لترجمة تسلسل الحمض النووي الريبي ويحمل معه الحمض الأميني.

أثناء النسخ ، يعطي الحمض النووي تعليماته إلى mRNA ويقوم بنسخها في نوع من الكود الذي يرتبط بحمض أميني معين. يحدث هذا في النواة. عند إجراء النسخ ، يتم إخراجها من النواة إلى السيتوبلازم. ثم يتم إحضار هذه الرسالة المنسوخة إلى الريبوسوم ، حيث ستبقى ليتم ترجمتها إلى أحماض أمينية.

أثناء الترجمة ، سيكون رمز الحمض النووي الذي تم نسخه إلى شفرة mRNA في الريبوسوم ، حيث سيحضر الحمض النووي الريبي الحمض الأميني الذي يحمله والمخصص لتسلسل تسلسل الرنا المرسال. يصطف الحمض النووي الريبي (tRNA) الخاص بالتسلسل ، وسوف تترابط الأحماض الأمينية التي تحملها معًا في نوع من السلسلة ، وتنتج بروتينًا معًا.

يستخدم الحمض النووي لصنع البروتين بناءً على الكود الذي يحمله. أيًا كانت الحبيبات المنقولة لـ mRNA من الحمض النووي ، لذلك حتى لو كان الحمض النووي الريبي هو ما ينتج البروتينات ، فسوف يعتمد على تسلسل الحمض النووي المعطى.

عند صنع حبلا تكميليًا للحمض النووي للخيط الأصلي ، كل ما تحتاج إلى تذكره هو الأزواج الأساسية:

يُعرف هذا باسم قاعدة Chargaff.

إذن ، أخذ مثالك الأول:

ومع ذلك ، عندما يتعلق الأمر بـ RNA ، لا يوجد ثايمين في الحمض النووي الريبي. لذلك بدلاً من الثايمين ، يتم استخدام اليوراسيل. ستكون أزواج القاعدة عندئذٍ:

مرة أخرى ، خذ مثالك:

النسخ: AUG AAC CAU UCA

أثناء الترجمة ، تكون الأحماض الأمينية رمزًا لرموز معينة ، أو مجموعات من 3 قواعد. يوضح الرسم البياني المعطى لك الغرض من كل كودون.


التنبؤ ببقايا ربط الحمض النووي في البروتينات من تسلسل الأحماض الأمينية باستخدام نموذج غابة عشوائي مع ميزة هجينة

التحفيز: في هذا العمل ، نهدف إلى تطوير نهج حسابي للتنبؤ بمواقع ربط الحمض النووي في البروتينات من تسلسل الأحماض الأمينية. لتجنب الإفراط في استخدام هذه الطريقة ، يتم استخدام جميع بروتينات ربط الحمض النووي المتاحة من بنك بيانات البروتين (PDB) لبناء النماذج. يتم استخدام خوارزمية الغابة العشوائية (RF) لأنها سريعة ولديها أداء قوي لقيم المعلمات المختلفة. يتم تقديم ميزة هجينة جديدة تتضمن المعلومات التطورية لتسلسل الأحماض الأمينية ومعلومات البنية الثانوية (SS) ومعلومات المتجه الثنائي المتعامد (OBV) التي تعكس خصائص 20 نوعًا من الأحماض الأمينية لخصائص فيزيائية كيميائية (ثنائيات أقطاب وأحجام من السلاسل الجانبية). عدد المخلفات الملزمة وغير الملزمة في البروتينات غير متوازنة إلى حد كبير ، لذلك يُقترح مخطط جديد للتعامل مع مشكلة مجموعات البيانات غير المتوازنة عن طريق تقليص فئة الأغلبية.

نتائج: أظهرت النتائج أن نموذج الترددات اللاسلكية يحقق 91.41٪ من الدقة الإجمالية مع معامل ارتباط ماثيو البالغ 0.70 ومساحة تحت منحنى خاصية تشغيل المستقبل (AUC) تبلغ 0.913. على حد علمنا ، فإن طريقة RF التي تستخدم الميزة الهجينة هي حاليًا النهج الحسابي الأمثل للتنبؤ بمواقع ربط الحمض النووي في البروتينات من تسلسل الأحماض الأمينية دون استخدام المعلومات الهيكلية ثلاثية الأبعاد (3D). لقد أثبتنا أن نتائج التنبؤ مفيدة لفهم تفاعلات البروتين والحمض النووي.

التوفر: يتوفر تنفيذ خادم الويب DBindR مجانًا على http://www.cbi.seu.edu.cn/DBindR/DBindR.htm.

الأرقام

دقة التنبؤ المتوقعة و ...

دقة التنبؤ المتوقعة وجزء التسلسلات مع كل RI بواسطة ...

مقارنات أداء الرسوم البيانية ROC ...

مقارنات أداء الرسوم البيانية ROC مع طرق أخرى. ( أ ) كلا المصنفين ...


ملفات بيانات إضافية

تتوفر البيانات الإضافية التالية مع النسخة الموجودة على الإنترنت من هذه الورقة. ملف البيانات الإضافي 1 عبارة عن مقطع موسيقي لبروتين ThyA البشري استنادًا إلى تخصيص النوتة الواحدة لحمض أميني واحد لكل ملاحظة موسيقية. ملف البيانات الإضافي 2 عبارة عن مقطع موسيقي لبروتين ThyA البشري المشتق من تعيين وتر النوتة المكونة من 13 قاعدة. ملف البيانات الإضافي 3 هو مقطع موسيقي لبروتين ThyA البشري بناءً على مهمة الترميز النهائية ، والتي تتضمن الإيقاع. ملف البيانات الإضافي 4 عبارة عن مقطع موسيقي لبروتين هنتنغتين بناءً على مهمة الترميز النهائية الخاصة بنا.


استرجع الحمض الأميني المشفر عندما يكون هناك نمط معين في تسلسل الحمض النووي

أرغب في استرداد الحمض الأميني المشفر عندما يكون هناك نمط معين في تسلسل الحمض النووي. على سبيل المثال ، يمكن أن يكون النمط: ATAGTA. لذلك ، عندما يكون لديك:

سيكون الناتج المثالي هو جدول يحتوي على عدد مرات ترميز كل حمض أميني بواسطة النمط. هنا في التسلسل 1 ، أكواد النمط فقط لحمض أميني واحد ، ولكن بالتسلسل 2 ترمز إلى اثنين. أرغب في استخدام هذه الأداة لتتسع لآلاف التسلسلات. لقد كنت أفكر في كيفية القيام بذلك ، لكنني فكرت فقط في: استبدال جميع النيوكليوتيدات المختلفة عن النمط ، وترجمة ما تبقى والحصول على ملخص للأحماض الأمينية المشفرة.

يرجى إعلامي إذا كان يمكن تنفيذ هذه المهمة بواسطة أداة متاحة بالفعل.

شكرا لمساعدتك. أتمنى لك كل خير ، برناردو

تحرير (بسبب الارتباك الناتج عن مشاركتي):

يرجى نسيان المنشور الأصلي و التسلسل 1 و التسلسل 2 أيضًا.

مرحبًا بالجميع ، وآسف على الارتباك. ملف fasta للإدخال هو ملف * .ffn مشتق من ملف GenBank باستخدام أداة 'FeatureExtract' (http://www.cbs.dtu.dk/services/FeatureExtract/download.php) ، لذلك يمكن أن يتخيل أنهم موجودون بالفعل frame (+1) وليس هناك حاجة للحصول على أحماض أمينية مشفرة في إطار مختلف عن +1.

أود أن أعرف أي حمض أميني ترميز التسلسلات التالية من أجله:

السلاسل الفريدة التي أرغب في الحصول عليها من الأحماض الأمينية المشفرة هي تكرارات ثلاثة AG أو GA أو CT أو TC ، أي (AG) 3 ، (GA) 3 ، (CT) 3 و (TC) 3 ، على التوالي. لا أريد أن يقوم البرنامج باسترداد ترميز الأحماض الأمينية لتكرار أربعة أو أكثر.


إيجاد الحمض النووي من مشكلة تسلسل الأحماض الأمينية - علم الأحياء

يستخدم الكود الجيني للترجمة من mRNA إلى بروتين. كل كودون مكون من ثلاثة أحرف يشفر إما حمض أميني أو يخبر الريبوسوم بإيقاف الترجمة. تتم قراءة الكودون في اتجاه 5 إلى 3 درجات. على سبيل المثال ، ترميز UGG لـ Trp (Tryptophan).

1. بالنظر إلى خيط المعنى التالي لتسلسل الحمض النووي ، قم بنسخه إلى mRNA ، مع توضيح اتجاه mRNA [أي 3 'و 5' ينتهي]. ثم قم بترجمة هذا التسلسل إلى بروتين [يشير إلى ترميني amino و carboxy ، تأكد من التحقق من وجود إطار قراءة مفتوح أيضًا.]

5 'ججاتكجاتجكككتتااجاجتتاكاتاتجكتجاجكجتتااككككجغا 3

2. لقد قمت للتو بتسلسل جزء قصير من الحمض النووي. أنت ترغب في تحليل تسلسل الحمض النووي هذا لتحديد ما إذا كان يمكن ترميز البروتين.

5 'TCAATGTAACGCGCTACCCGGAGCTCTGGCCCAAATTTCATCCACT 3'

1. ابحث عن أطول إطار قراءة مفتوح (ORF). تذكر ، هناك ستة احتمالات.

2. ضع علامة على الخيط الموجود على الحمض النووي سيكون خصلة الإحساس ، والذي سيكون مضادًا للمعنى عندما يتم نسخ هذا الحمض النووي.

3. انسخ ORF هذا إلى mRNA ، مشيرًا إلى نهايتي 5 'و 3'.

4. ترجم هذا mRNA إلى أحماض أمينية ، مشيرا إلى النهايات الأمينية (N) والكربوكسي (C).


إيجاد الحمض النووي من مشكلة تسلسل الأحماض الأمينية - علم الأحياء

في التمرين أدناه ، ستحصل على تسلسل DNA غير معروف وسيُطلب منك استخدام أداة ويب لترجمة التسلسل إلى تسلسل الأحماض الأمينية ونأمل أن تحدد إطار القراءة المناسب. ستقوم بعد ذلك بحفظ تسلسل الأحماض الأمينية هذا في برنامج معالجة الكلمات (أو إرساله بالبريد الإلكتروني إلى نفسك) إذا كنت تريد استخدامه في التمرين التالي.

الحصول على التسلسل الخاص بك
في المختبر ، يمكن الحصول على هذا عن طريق تسلسل استنساخ من مكتبة cDNA أو عن طريق عزل جزء DNA مضخم من تضخيم PCR. في كثير من الأحيان ، عندما نتسلسل مثل هذا المنتج ، نجد أن لدينا جزءًا غير متوقع من الحمض النووي الذي نحتاج إلى تحليله. سنقدم هنا تسلسلًا جزئيًا عشوائيًا من قاعدة بيانات التسلسلات الخاصة بنا. سيظهر تسلسل جزئي للنيوكليوتيدات في النافذة أدناه بعد النقر على زر الحصول على تسلسل الجينات.

ترجمة التسلسل
تقوم العديد من المواقع على الويب بترجمة تسلسل الإدخال. سيؤدي النقر فوق رابط Expasy أدناه إلى فتح نافذة جديدة تتيح لك الوصول إلى أداة الترجمة. تتم ترجمة تسلسل الحمض النووي من خلال قراءة تسلسل النوكليوتيدات بثلاث قواعد في وقت واحد ثم النظر إلى جدول الشفرة الوراثية للوصول إلى تسلسل الأحماض الأمينية. يفحص هذا البرنامج تسلسل الإدخال في جميع الإطارات الستة الممكنة (أي قراءة التسلسل من 5 'إلى 3' ومن 3 'إلى 5' بدءًا من nt 1 و nt 2 و nt 3). ما نبحث عنه عادةً في تحديد الترجمة المناسبة هو الإطار الذي يعطي أطول تسلسل للأحماض الأمينية قبل مواجهة رمز الإيقاف. (نظرًا لوجود 64 كودونًا وثلاثة أكواد للهراء ، نتوقع أن يظهر رمز الإيقاف في المتوسط ​​مرة واحدة كل 20 حمضًا أمينيًا إذا قرأنا ببساطة تسلسل "خارج الإطار". ومع ذلك ، "في المتوسط" هو هذا فقط ، وهو من الممكن أن يكون لديك إطار قراءة غير صحيح يعطي تسلسلًا ممتدًا بدون أكواد توقف. سيعالج التمرين التالي هذه المشكلة.

سوف نستخدم أدوات إكسبسي للترجمة. سيؤدي النقر فوقه إلى فتح نافذة جديدة حتى تتمكن من العودة إلى هذه النافذة للحصول على الإرشادات ونسخ التسلسل الخاص بك.


النتائج

يوضح الجدول 1 أداء المصنفات SVM في عمليات التحقق من صحة 5 أضعاف. تم الحصول على النتائج باستخدام معايير التدريب ، ج = 0.5 و γ = 0.1 ، مما يعطي نتائج أفضل من القيم الأخرى للتنبؤ بكل من بقايا ربط الحمض النووي الريبي والحمض النووي الريبي. يحقق المصنف لبقايا ربط الحمض النووي دقة إجمالية تبلغ 70.31٪ مع حساسية 69.40٪ وخصوصية 70.47٪. بالنسبة لبقايا ربط الحمض النووي الريبي ، يمكن إجراء التنبؤات بدقة إجمالية تبلغ 69.32٪ مع حساسية 66.28٪ وخصوصية 69.84٪ (الجدول 1).

تظهر منحنيات ROC للتنبؤ ببقايا ربط الحمض النووي الريبي والحمض النووي الريبي في الشكل 1. تم إنشاء منحنيات ROC هذه عن طريق تغيير عتبة الإخراج لمصنفات SVM وتخطيط المعدل الإيجابي الحقيقي مقابل المعدل الإيجابي الخاطئ لكل من قيم العتبة. عتبة الإخراج الافتراضية التي يستخدمها SVMlight هي 0 ، وبالتالي فإن جميع المخرجات ≥0 تؤدي إلى تنبؤات إيجابية والمخرجات & lt0 تؤدي إلى تنبؤات سلبية. عند استخدام عتبات أعلى ، يتم توقع فقط مثيلات البيانات ذات قيم الإخراج الأعلى نسبيًا كإيجابيات وبالتالي يصبح المعدل الإيجابي الحقيقي (الحساسية) أقل. وفي الوقت نفسه ، مع العتبات الأعلى ، تصبح النوعية أعلى ولكن المعدل الإيجابي الكاذب (1 - الخصوصية) ينخفض. لذلك ، تمثل كل نقطة على منحنى ROC المقايضة بين الحساسية والنوعية. يتم استخدام منحنيات ROC الموضحة في الشكل 1 بواسطة خادم الويب BindN للسماح للمستخدمين بتحديد المستوى المطلوب من الخصوصية أو الحساسية (انظر أدناه).

يُظهر تحليل ROC أن المصنف لبقايا ربط الحمض النووي أكثر دقة قليلاً من المصنف لبقايا ربط الحمض النووي الريبي ، باستثناء المعدلات الإيجابية الخاطئة المنخفضة جدًا (الشكل 1). قيم AUC هي 0.7524 و 0.7308 للتنبؤ بمخلفات ربط DNA و RNA ، على التوالي (الجدول 1). قيم AUC هذه أعلى بكثير من التخمين العشوائي (0.5).

يبدو أن مُصنِّف SVM لبقايا ربط الحمض النووي أفضل من متنبئات الشبكة العصبية السابقة التي تم إنشاؤها باستخدام نفس مجموعة البيانات (PDNA-62). متوسط ​​حساسية ونوعية SVM هو 69.94٪ ، في حين أن المتوسط ​​(يسمى أيضًا "التنبؤ الصافي") كان 61.1٪ للشبكة العصبية المدربة بمعلومات التسلسل وإمكانية الوصول إلى المذيبات المتبقية (8). أدى النهج القائم على PSSM إلى تحسين "التنبؤ الصافي" إلى 67.1٪ (11) ، ولكنه تطلب حسابًا مكثفًا لاستخراج الميزات. في المقابل ، فإن ميزات التسلسل الثلاثة المستخدمة في نهجنا فعالة للغاية للحساب وبالتالي فهي مناسبة تمامًا للتنبؤات عبر الإنترنت.

للمقارنة المباشرة للمصنفات SVM والشبكة العصبية ، تم جمع مجموعة بيانات اختبار منفصلة من مجمعات البروتين والحمض النووي المتوفرة في PDB. كما هو مدرج في الجدول التكميلي 3 ، تحتوي مجموعة بيانات الاختبار على 92 سلسلة من الأحماض الأمينية. تُظهر هذه التسلسلات & lt30٪ هوية فيما بينها ومع أي تسلسلات في مجموعة بيانات PDNA-62. باستثناء القيود المذكورة أعلاه ، تمت معالجة مجموعة بيانات الاختبار بنفس الطريقة الموضحة لمجموعة بيانات PRINR25. تم التنبؤ ببقايا ربط الحمض النووي المفترضة باستخدام كل من BindN و DBS-PSSM. تم إنشاء خادم الويب DBS-PSSM المتاح على http://www.netasa.org/dbs-pssm/ باستخدام نهج الشبكة العصبية القائم على PSSM (11). تم إجراء التنبؤات بالنوعية المتوقعة عند 72.3٪ ، وهو مسموح به في خادم DBS-PSSM (لا يسمح DBS-PSSM للمستخدمين بتحديد مستويات الخصوصية المطلوبة). كما هو مبين في الجدول 2 ، فإن مستويات الخصوصية الفعلية التي حققها الخادمان قريبة من القيمة المتوقعة. ومع ذلك ، تحقق BindN مستوى حساسية أعلى بكثير من DBS-PSSM (65.22 مقابل 36.73٪). في حين أن الخصوصية التي حققتها BindN (65.22٪) قريبة من القيمة المتوقعة بناءً على تحليل ROC (67.19٪) ، فإن الخصوصية الفعلية لـ DBS-PSSM لا تصل إلى المستوى المتوقع (60.2٪) في مجموعة بيانات الاختبار الجديدة ، على الأرجح بسبب سوء التعميم لبقايا ربط الحمض النووي التمثيلية في مجموعة بيانات التدريب الصغيرة نسبيًا (PDNA-62).

تم إنشاء المصنفات SVM باستخدام بروتينات مرتبطة بالحمض النووي أو الحمض النووي الريبي المعروفة. تم استخدام البقايا التي لا ترتبط بالحمض النووي أو الحمض النووي الريبي كحالات بيانات سلبية للتدريب. لمزيد من التقييم لمصنفات SVM ، قمنا بتحليل مجموعة من 100 بروتين لا يتفاعل مع DNA أو RNA. تم اختيار تسلسلات البروتين المدرجة في الجدول التكميلي 4 بشكل عشوائي من قاعدة بيانات Swiss-Prot (http://www.expasy.org/sprot/). عندما يتم تحليل هذه التسلسلات باستخدام BindN مع النوعية المتوقعة عند 80٪ (القيمة الافتراضية) ، فإن مستويات الخصوصية الفعلية التي حققتها المصنفات SVM هي 81.58 و 80.86٪ لتحليل بقايا ربط الحمض النووي الريبي (DNA) و RNA ، على التوالي. تشير النتائج إلى أن BindN يمكن الاعتماد عليه في تحقيق مستويات محددة من قبل المستخدم من الخصوصية للبروتينات المختلفة. وبالتالي ، يمكن استخدام بروتينات ربط الحمض النووي أو الحمض النووي الريبي المفترضة ذات المجالات الوظيفية غير المميزة كمدخلات لـ BindN. إذا كان عدد مخلفات الربط المتوقعة أعلى بكثير من العدد المتوقع للإيجابيات الخاطئة ، فيمكن استخدام نتائج التنبؤ لتوجيه التوصيف التجريبي لهذه البروتينات.

لإثبات أن BindN يمكن أن توفر معلومات مفيدة لفهم تفاعلات البروتين والحمض النووي ، قمنا بفحص بقايا الارتباط المتوقعة في سياق الهياكل ثلاثية الأبعاد. يوضح الشكل 2 مثالين تمثيليين للنتائج. في الشكل 2 أ ، يتم التحقق من مخلفات ربط الحمض النووي المفترضة التي تنبأت بها BindN لعامل نسخ الماوس ETS-1 باستخدام البيانات الهيكلية المتاحة (معرف PDB: 1K79). تشتمل البنية على مخلفات 331-440 من بروتين ETS-1 ، والتي لم يتم استخدامها لتدريب مصنف SVM. المتماثل الوحيد في مجموعة بيانات PDNA-62 هو مجال ربط الحمض النووي PU.1 (معرف PDB: 1PUE) ، والذي يحتوي على هوية تسلسلية بنسبة 28 ٪ مع ببتيد ETS-1. كما هو مبين في الشكل 2 أ ، يتم توقع 10 من أصل 16 من مخلفات ربط الحمض النووي (62.50٪) بشكل صحيح من بيانات تسلسل الأحماض الأمينية. يتم تمييز هذه الإيجابيات الحقيقية باللون الأحمر. البقايا باللون الأزرق هي السلبيات الكاذبة الست (بقايا ربط الحمض النووي ولكن يتم توقعها على أنها سلبية). بالنسبة لـ 88 وحدة بنائية غير ملزمة ، يتم توقع 79 أو 89.77٪ بشكل صحيح (بقايا باللون الأخضر) ، والتي تتوافق جيدًا مع مستوى الجودة المطلوب عند 90٪. ومع ذلك ، فإن تسعة من البقايا غير الملزمة يتم توقعها بشكل غير صحيح (إيجابيات خاطئة باللون الأصفر). في الشكل 2 ب ، يتم فحص المخلفات المفترضة لربط الحمض النووي الريبي المتوقعة للبروتين البدائي L7Ae (مربع C / D مجال ربط الحمض النووي الريبي). لم يتم تضمين السلسلة B للهيكل (معرف PDB: 1RLG) في مجموعة البيانات PRINR25 ، ولكنها تُظهر هوية تسلسل 34 ٪ مع بيانات التدريب ، 1E7K_A (بروتين لصق بشري 15.5 KDa). يتم إجراء تنبؤات صحيحة لـ 6 من 13 من البقايا الملزمة للـ RNA (46.15٪) و 96 من 104 مخلفات غير ملزمة (92.31٪). لذلك ، يمكن للتنبؤات التي قدمتها BindN أن توفر معلومات مفيدة لفهم تفاعلات البروتين والحمض النووي. يمكن استخدام هذه المعلومات لتوجيه الدراسات التجريبية مثل الطفرات الموجهة للموقع من أجل التوصيف الوظيفي لبروتينات ربط الحمض النووي أو الحمض النووي الريبي.


القواعد الثلاث البسيطة لتحديد سلسلة الأحماض الأمينية من قطعة DNA بدون أخطاء!

القاعدة الأولى: نلاحظ بعناية قطعة الحمض النووي المزدوجة التي تقطعت بهم السبل. حدد الشريط المكتوب (القالب) والشريط غير المكتوب. اكتبها في دفتر النسخ الخاص بك مع تحديد اسم كل منها. حاول فصل كل 3 أحرف بشرطة (لأن كل 3 نيوكليوتيدات تمثل كودونًا واحدًا وستكون رمزًا لحمض أميني واحد فقط).

حبلا DNA المنسوخة / القالب:

TAC & # 8211 TGC- CTA- GTC- GGC- GTT- CGC- CTT- AAC & # 8211 CGC TGT-ATT.

حبلا DNA غير المنسوخ:

ATG-ACG-GAT-CAG-CCG-CAA-GCG-GAA-TTG-GCG-ACA-TAA.

القاعدة الثانية: اكتب m-RNA بطريقة تكميلية لخيط DNA المنسوخ. (A من m-RNA مرتبط بـ T لـ DNA U لـ m-RNA مرتبط بـ A من DNA).

A U G – ACG – GA U & # 8211 CAG – CCG – CAA – GCG – GAA- UU G – GCG – ACA- U AA.

ملحوظة: للتحقق من تسلسل m-RNA الصحيح ، ما عليك سوى مقارنته بحبلا DNA غير المكتوب ، يجب أن يكون له نفس التسلسل ولكن بدلاً من T & amp m-RNA سيكون له U.

خيط الحمض النووي غير المنسوخ:

A T G-ACG- GA T & # 8211 CAG- CCG- CAA- GCG-GAA- TT G-GCG-ACA- T AA.

القاعدة الثالثة: استخدم الكود الجيني لتحديد تسلسل الحمض الأميني الصحيح في السلسلة المشفرة بواسطة m-RNA.

هذه الشفرة الوراثية تشبه قاموسًا يترجم لغتين: لغة m-RNA إلى لغة الأحماض الأمينية. إذن ما تراه على يسارك هو رمز m-RNA (ثلاثة أحرف) وعلى يمينك هو الاسم الرمزي للحمض الأميني. كل ما عليك فعله هو متابعة مواضع الحروف (كودونات RNA) على الطاولة والعثور على تطابقها مع الأحماض الأمينية.

AUG-ACG-GAU-CAG-CCG-CAA-GCG-GAA-UUG-GCG-ACA-UAA.

Met - Thr - Asp- Gln & # 8211 Pro- Gln - Ala - Glu - Leu - Ala - Thr -.

ملحوظة: عادةً ما تبدأ سلسلة الأحماض الأمينية المركبة بالميثيونين (Met) ويكون الكودون الأخير في m-RNA عبارة عن كودون توقف لا يرمز إلى أي أحماض أمينية. (عادة ما يكون عدد الأحماض الأمينية أقل من عدد أكواد m-RNA بمقدار واحد)


شاهد الفيديو: شرح الحمض النووى بأسهل طريقه مهم لأولى وتانيه وتالته ثانوى 1 (أغسطس 2022).