معلومة

ماذا يحدث إذا قمنا بحقن إنزيم تقييد في الدم

ماذا يحدث إذا قمنا بحقن إنزيم تقييد في الدم



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

مجرد سؤال غريب ، إذا استخرجنا إنزيم تقييد وحقنه في أجسامنا ، ماذا يحدث؟

  • هل يتعرف الجسم المضاد عليه ويمنعه؟
  • هل يمكن أن يمر إنزيم التقييد فوق غشاء الخلية ويدمر الحمض النووي للخلية الحية؟

يجب أن يؤدي ظهور أي مستضدات أجنبية (على سبيل المثال ، البروتينات مثل إنزيمات التقييد التي تقع في هذه الفئة) في الجهاز الدوري إلى استجابة مناعية.

يوجد في الواقع حاجزان غشيان يجب على الإنزيمات اجتيازهما للوصول إلى الجينوم النووي: غشاء الخلية والغشاء النووي. عادة ما تكون البروتينات كبيرة جدًا ومشحونة جدًا بحيث لا يمكنها عبور غشاء ثنائي الطبقة الدهنية - ما لم يكن هناك مسام (مثل الغشاء النووي) أو مستقبل للبروتين على سطح الخلية.

عندما يتم هندسة الخلايا للتعبير عن إنزيمات التقييد الأجنبية باستخدام الجينات المحورة ، فعندئذ نعم ، إذا كان البروتين يمكن أن يدخل النواة ، فسيبدأ الإنزيم في هضم جميع مواقع التعرف عليه.

أظهر جاسبر راين هذا لخميرة بيكر S. cerevisiae في عام 1986.


اكتشاف أنزيمات التقييد

قم بتنزيل الفيديو من iTunes U أو Internet Archive.

حسنًا ، أود الآن الانتقال إلى الجزء التالي من الدورة التدريبية.

أعتقد أنه يمكنك على الأرجح تقدير هذا المثلث الذي كان لدي من قبل بشكل أفضل قليلاً حول ما فعله علماء الكيمياء الحيوية هو أنهم يميلون إلى فتح الخلايا ، والنظر إلى الأجزاء المكونة ، من خلال أشياء أخرى هناك ، ثم البروتينات.

لكن الكثير من الأشياء التي لها علاقة بالوظيفة هي البروتينات ، وما سيفعله علماء الوراثة ، علم الوراثة ، الذي صنع طفرات من الكائنات الحية ، والتي بحثت في كيفية تأثر الوظيفة بتحور الجينات الفردية ، وكيف كان كلاهما شديدًا مقاربات قوية. أخبرك علم الوراثة بما هو مهم حقًا ، وأخبرتك الكيمياء الحيوية كيف يعمل على المستوى الجزيئي ، لكن المشكلة الحقيقية هي معرفة ما إذا كان هذا الشيء الذي قمت بفعله في أنبوب الاختبار هو الشيء الذي فعلته في الحياة.

وأعتقد أنه سيفعل عندما عزل آرثر كورنبرج أول بوليميريز DNA ، كان قادرًا على نسخ الحمض النووي. وحصل على جائزة نوبل ، وكان أول إنزيم يمكنه نسخ الحمض النووي ، ثم صنع جون كارينز طفرة تفتقر إلى الإنزيم. وكان الكائن الحي لا يزال على قيد الحياة.

لذلك ، لا يمكن أن يكون بوليميراز الدنا هو الذي ينسخ الكروموسوم. لقد تبين في الواقع أنه إنزيم لإصلاح الحمض النووي. لذا ، إذا كان بإمكانك بالفعل توحيد علم الوراثة والكيمياء الحيوية ، إذا كان بإمكانك أن تأخذ متحولة مكسورة في وظيفة ووجدت أن البروتين الخاص بك مفقود ، أو العكس ، عندها يكون لديك رؤية قوية جدًا لأنك تربط معرفتك بما كانت مهمة من الناحية الفسيولوجية للكيمياء الحيوية التي تقوم بها. لكن كان الأمر صعبًا حقًا لسنوات ، وفقط في حالات نادرة جدًا ، كان لدى بعض علماء الوراثة طفرة تشير بقوة إلى أن بعض علماء الكيمياء الحيوية سيبحثون ، أو أن بعض علماء الكيمياء الحيوية لديهم نتيجة قوية لدرجة أنهم تحدثوا إلى عالم الوراثة ورأوا ما إذا كان وجد أي شخص النتيجة.

وقوة الحمض النووي المؤتلف ، على الرغم من أنها بدأت صناعة التكنولوجيا الحيوية ، وجعلت من الممكن تسلسل الجينوم ، هناك مستوى آخر أعلى في الفهم المفاهيمي.

وما فعله هو أنه سمح لك بالذهاب ذهابًا وإيابًا بين هنا وهنا.

لن تواجه أي مشكلة الآن إذا أعطيتك تسلسل الجين ، يمكنك طلب ذلك. يمكنك لصقها في خلية وإنتاج كميات هائلة من البروتين. لقد قمت بتنقيتها عشرين ضعفًا وستكون نقية ، بينما قبل ذلك كان من الممكن أن تضطر إلى تنقيتها خمسة عشر ألف ضعف من 1000 جرام من الخلايا ، وكان عليك أن تكون عالم كيمياء حيوية جيد جدًا مع 15 خطوة من أجل التنقية. هو - هي. لذا ، يمكنك الانتقال من تسلسل الجين إلى البروتين ، أو إذا حصلنا على بروتين وأردنا معرفة الجين الذي سنقوم به للتو بتسلسل جزء من البروتين ، واستخدام هذا الرمز الجيني ، والعمل على أنفسنا بشكل عكسي لبعض ما هو ممكن التسلسل ، ثم ابحث عن التسلسلات ، ثم اذهب للعثور على الجين. لذا ، ما يسمح لنا الحمض النووي المؤتلف بالقيام به هو إغلاق تلك الحلقة. يمكنك الانتقال من علم الوراثة إلى الكيمياء الحيوية ذهابًا وإيابًا. الآن الجميع يفعل كل شيء بدلاً من أن يكون مجرد تخصصات منفصلة ، وهو ما حدث عندما دخلت المجال. لذلك ، اعتمدت كل الأشياء على التطور لاستنساخ قطع معينة من الحمض النووي.

وأريد أن أوضح في البداية ، هناك استخدامان شائعان للاستنساخ في الوقت الحالي. ما نتحدث عنه في هذه المحاضرة هو استنساخ قطعة من الحمض النووي. ما يعنيه ذلك ، هو أنني سأأخذ قطعة معينة من الحمض النووي ، لنقل ، اقطعها هنا ، وأقطعها هناك.

وسوف آخذ هذه القطعة ، وسأفعل شيئًا لها يسمح لي بتضخيمها وصنع العديد والعديد من النسخ من تلك القطعة من الحمض النووي. واستنساخ أي شيء آخر تقوم بعمل عدد كبير من النسخ.

إذن هذا أحد استخدامات كلمة الاستنساخ.

الاستخدام الآخر ، الذي تراه في الصحافة الشعبية طوال الوقت ، هو استنساخ فرد ، ولكن ليس هناك ، لكنك ستأخذ النواة من خلية الفرد ، فقد وضع تلك النواة في بيضة لا تحتوي على تم نقل النواة الخاصة بك ، والآن تأمل أن ما تحصل عليه من ذلك هو كائن حي له نفس المحتوى الجيني مثل الفرد البادئ.

وفي الواقع ، على الرغم من أن الأمر يبدو جيدًا جدًا على الورق ، فربما تكون قد بدأت في رؤية أنه ليس الدواء الشافي الذي اعتقد الناس أنه كان كذلك ، أو أنه يتعين علينا القلق من أنه في غضون 10 سنوات ، سيكون جميع طلاب معهد ماساتشوستس للتكنولوجيا (MIT) استنساخ لألمع شخص في الفصل أو أي شيء من هذا القبيل ، لأن أشياء أخرى تحدث ، لأنه ما لم تذهب إلى دورات علم الأحياء المتقدمة ، ولكن هناك تعديلات على الحمض النووي. هناك كل أنواع الأشياء التي تحدث لها ، لذا فهي ليست متطابقة.

والعديد من هذه الكائنات الحية المستنسخة ، مثل النعجة دوللي ، التي كانت مشهورة ، ماتت مبكرًا ، نسيت ، التهاب المفاصل وأشياء أخرى. لذلك ، هناك الكثير من المشاكل في هذا الصدد. لكن هذا هو الاستخدام الآخر لكلمة الاستنساخ وهذا ليس ما في المحاضرات الثلاث التالية التي نتحدث عنها عن استنساخ قطعة من الحمض النووي. وكانت تلك هي المشكلة الكبيرة التي واجهت المجال ، وبالتأكيد عندما كنت طالبًا جامعيًا وحتى عندما كنت طالبًا متخرجًا كنت مهتمًا بتركيب أجزاء من الحمض النووي ، وكان أحد تلك الأشياء التي قالها الناس ، لماذا تفعل ذلك ؟ حسنًا ، لأنه يمكنك محاولة القيام بذلك. ماذا لو حصلت على قطعة من الحمض النووي ، مثل Gobind Khorana ، وهو زميلي ، الذي حصل على جائزة نوبل لتخليق الجين الأول.

لقد صنعها. كان جين الحمض الريبي النووي النقال بطول 120 زوجًا من قاعدة النوكليوتيدات أو شيء من هذا القبيل. لقد صنعها.

لقد أظهر أنه يمكنك فعل ذلك. لكن لا يمكنك فعل أي شيء به.

وكان هناك نوع من مشكلتين كبيرتين. كان أحدها حقيقة أن هذا الحمض النووي ، على الرغم من أنه ليس رتابة رباعي النوكليوتيد.

من الصعب جدا معرفة ذلك. كل واحد من هذه الأشياء هو زوج أساسي ، والحمض النووي البشري لديه 3 مليارات من هؤلاء. والقليل هنا ، لا يبدو مختلفًا تمامًا عن الجزء الموجود هناك.

وبالتأكيد لن يبدو مختلفًا تمامًا عن جزء الحمض النووي الذي يبلغ ملياري زوج قاعدي على الجانب الآخر من الحرم الجامعي أو شيء من هذا القبيل. لذلك ، لا توجد طريقة لأخذ الحمض النووي وتقطيعه بشكل متكاثر ، لذلك تحصل على شظايا.

ما يمكن أن تراه من المبادئ الأولى هو ما كنت بحاجة إليه هو المقص السحري. وكيف سيبدو المقص؟ حسنًا ، يجب أن يكون مقصًا يمكن تسلسله لأنه لا يوجد شيء آخر مختلف. أنت تعلم أنه عمود فقري منتظم ، ويتكون من أربعة نيوكليوتيدات فقط. لذا ، إذا أردت قطع الحمض النووي في أماكن معينة ، يجب أن يكون لديك مقص يمكنه رؤية التسلسل.

علاوة على ذلك ، يمكنكم أن تروا أنهم لا يستطيعون فقط ، هناك أجزاء رابطة الهيدروجين من ANT أو GNC لأن هذه الأجزاء ملتصقة ببعضها البعض هناك في منتصف الحمض النووي.

لذلك ، ستحتاج إلى مقص يمكنه بطريقة ما إيجاد تسلسل وإجراء قطع. وقد تم العثور عليها. أنا ذاهب حتى أنت بشأن هؤلاء.

إنها تسمى إنزيمات التقييد. لذلك كان هذا جزءًا من الشيء. الشيء الآخر هو ، تخيل أنه يمكنني قطع هذه القطعة. وقد أعطوها لك وقلت عظيم. الآن لقد حصلت عليه.

هل ستصنع لي الكثير من النسخ من هذا الحمض النووي؟

هل يمكن أن تفعل ذلك؟ لنفترض أنك تعرف الآن كيفية تحويل المبدأ الذي رأيناه مرة أخرى مع Avery.

يمكننا أخذ الحمض النووي العاري ووضع هذه القطعة في الخلية.

هل سيتكرر؟ ماذا تعتقد؟ هل يتذكر أحد؟

لا؟ حسنًا ، تحدثنا عن بعض اللغات الأخرى ، أليس كذلك؟

لكن أحد الأشياء الموجودة في الحمض النووي هو الشفرة الجينية لكل الجينات. ويمكننا إيجاد إطار القراءة. تذكر عندما تحدثنا عن أصل النسخ المتماثل. قلت أن هذا نوعًا ما ، على الأقل بالنسبة للإشريكية القولونية ، هناك أصل واحد. في حقيقيات النوى ، تتباعد الأصول على طول الحمض النووي. وفي كل مرة يكون لديك جولة تكرار ، تبدأ بأحد تلك الأصول ثم تذهب.

لذا فإن فرصة الحصول على هذه القطعة من الحمض النووي بالصدفة ستكون صغيرة جدًا. لذا إذا وضعته في كائن حي ، فسيجلس هناك ، إذا كنت محظوظًا ، اجعله يتحلل لأنه يحتوي على [مزيج داخلي؟ ، أو حتى إذا جعلته في دائرة ، فمن المحتمل ألا يتكاثر لأنه ربما لا يحتوي على الكلمة في الحمض النووي التي تقول بدء جولة من تكرار الحمض النووي.

لذا ، فإن المبدأ الشامل الآخر لتكرار الحمض النووي هو أنك بطريقة ما يجب أن تأخذ جزء من الحمض النووي الذي تنظر إليه ، وعليك إرفاقه بأصل النسخ المتماثل.

الآن ، إذا كان لديك أصل النسخ ولديك جزء من الحمض النووي ، وقمت بوضعه في الخلية ، الآن ستحصل على الكثير من نسخ تلك القطعة من الحمض النووي. هذا ما يدور حوله الحمض النووي المؤتلف في شكل بسيط حقًا. سأأخذك الآن إلى نوع متزايد من مستويات التفاصيل.

لذا ، اسمحوا لي أن أقدم لكم نوعًا من النظرة الشاملة حقًا لهذا الاستنساخ ، وبعد ذلك سنبدأ نوعًا ما في الغوص في بعض تقنيات مربو الحيوانات التي نتجت عن هذا.

سنتحدث عن تسلسل الحمض النووي ، و PCR ، وأشياء في المحاضرة القادمة. لذا فإن المبدأ الأول هنا هو قطع الحمض النووي ، وأنا أعلم أنك قد تعتقد أن هذا نوع من حديث الأطفال ، لكن هذه هي الطريقة التي أفكر بها. إذا كنت تفكر حقًا في هذه الأشياء ، فهذا ما هو عليه حقًا. باستخدام المقص الجزيئي المتسلسل المحدد ، يكون لها اسم غريب نوعًا ما.

إنها تسمى إنزيمات التقييد. لا أعرف ما إذا كان أي منكم يعرف سبب تسميته بالإنزيمات التقييدية ، وعلى الرغم من أنني متأكد من أن بعضكم قد استخدمها في عمليتك لتقطيع أجزاء من الحمض النووي.

لكن ما يفعله ذلك ، هذه إنزيمات ، كما سأخبركم ، تتعرف على تسلسل معين. ودائما يقطعون هذا التسلسل. في قيمة ذلك ، يمكنك قطع الحمض النووي بشكل متكرر في نفس البقعة تمامًا ، ويتم تحديد البقع بأي تسلسل يعرفه هذا الزوج المعين من المقص كيف يقرأ.

ثم الشيء التالي الذي يتعين علينا القيام به هو أننا بحاجة إلى ربط قطعة الحمض النووي بأصل النسخ المتماثل. لذا فإن الشيء الذي يحمل أصل النسخ المتماثل يسمى المتجه. وعادةً ، ليس دائمًا ، هذه دوائر. سوف نعتبر أن تلك التي تنمو في الإشريكية القولونية هي في معظم الأحيان ، أو في البكتيريا ، في الغالب في الدوائر.

هم الذين يستخدمون على نطاق واسع في معظم الاستنساخ.

لذا ، سنتحدث عن هؤلاء. ما الذي يجعل المتجه؟ عندما يجب أن يكون أصلًا لتكرار الحمض النووي. عادة ما يكون لديهم شيء آخر. يمكننا أن نسميها علامة قابلة للتحديد ، لكنها شيء مثل مقاومة الأدوية.

إذا قام أي منكم بالاستنساخ في UROP فعادة ما يكون شيئًا مثل الجين لجعل خلية الأمبيسلين مقاومة ، أو مقاومة التتراسيكلين ، بعض المضادات الحيوية التي تقتل الخلية بشكل طبيعي.

لذا يمكنك معرفة ، هل تحتوي هذه الخلية على هذا المتجه أم لا لأن الخلية تبدأ عند حساس للأمبيسيلين.

يكتسب المتجه الذي يكرره ، كما يكتسب الجين الذي يمنحه مقاومة الأدوية.

لكن إذا كنا سنقطع ذلك ، إذا أردنا ضم قطعة من الحمض النووي إلى ذلك ، لا يمكننا الانضمام إلى دائرة دون كسرها.

لذلك ، نحن بحاجة إلى قطع المتجه في موقع فريد. وسنستخدم إنزيم تقييد لذلك. ويمكنك أيضًا أن ترى في تصميم متجه ، فأنت تريد شيئًا له موقع واحد فقط.

لذا ، ما كنا سنحققه من هذا المفهوم من الناحية المفاهيمية لأننا حصلنا الآن على هذا ، هذا هو المتجه ، وأصل النسخ المتماثل هنا ، ودعونا نقول مقاومة الأمبيسلين ، على سبيل المثال ، كعلامة قابلة للتحديد ، يمكن ترميز الجين الخاص بذلك هنا. ولدينا جزء من ، إذا كنت تريد ذلك ، فقط ضعه على الأرض ، على ما أعتقد. لقد أوضحنا هذه النقطة في هذه المرحلة. شكرا.

ما على المرء أن يفعله هو أن ينضم إلى هذه القطعة من الحمض النووي.

وسننتقل إلى التفاصيل الجزيئية لهذا.

لكن ، سننضم الجزء إلى المتجه ، وفي الواقع كان هذا شيئًا موجودًا بالفعل في مجموعة أدوات علماء الأحياء الجزيئية ، كانوا يدرسون تكرار الحمض النووي. هذا DNA ligase.

عندما ننتهي من قطعة أوكازاكي ، كان علينا إغلاق [غير واضح] والإنزيم الذي فعل ذلك كان إنزيمًا يسمى DNA ligase.

لذلك ، كان لدى علماء الأحياء الجزيئية الشريط اللاصق أو الغراء لربط الأشياء معًا مرة أخرى. ما كانوا يفتقدونه لسنوات عديدة حيث تسلسل مقص جزيئي محدد.

لذا في هذه المرحلة ، إذا كنا نقوم بعمل الحمض النووي المؤتلف ، لدينا الآن ناقل. لدينا الآن قطعة من الحمض النووي مرتبطة بها. في الواقع ، ربما لدينا فوضى أخرى كاملة من الأشياء التي تحدث على طول الطريق.

لكن في الوقت الحالي ، هم في أنبوب اختبار.

لذا ، إذا أردنا أن ينمو هذا الشيء ، فماذا علينا أن نفعل بعد ذلك؟

سيتعين علينا الحصول على الحمض النووي من خارج الخلية داخل الخلية. هذه هي الكلمة التي نحتاجها لتحويل الحمض النووي إلى خلية.

مرة أخرى ، كلمة تحويل ، التي تعود إلى تجارب التحول تلك مع Streptococcus pneumonia التي تنتقل من ناعمة إلى خشنة ، وأنت تأخذ أشياء من الخلية التي حولتها من خشنة إلى ناعمة ، أيا كان ، هذا هو المكان الذي جاءت منه الكلمة ، لكننا تعرف الآن أنها تحصل على حمض نووي عارٍ داخل الخلية حيث يمكن تكراره.

ثم الشيء التالي الذي نحتاج إلى معرفته هو ، ما هي الخلايا التي اكتسبت هذا المتجه على الأقل باعتباره المتجه.

سنستقر على ذلك في البداية ، وللقيام بذلك ، تحتاج إلى تحديد العلامة على المتجه. في حالة هذا ، سنبدأ بسلالة قتلت الأمبيسلين الخاص بي ، ثم نلعبها ونطلب الرجال الذين يقاومون الأمبيسلين. ويمكنك أن ترى أن هناك فئة أخرى من المشاكل لأنه إذا كان لدينا ناقل غير مقطوع ، ومن المحتمل أن يكون هناك ، بالتأكيد ، بعضًا من ذلك في مزيجنا ، من شأنه أن يجعل الخلايا أمبيسيلين. وإذا كان لدينا ملحق ، فسيكون أيضًا أمبيسلين. لذا ، إذا أردنا حقًا الدخول في هذا الأمر ، فسيتعين علينا القيام ببعض العمل الإضافي لفرز ما يوجد هناك.

لكن هذه هي الأشياء الأساسية. أظن أن معظمكم يعرف هذا عمليا منذ روضة الأطفال. ولكن هذا هو الإطار العام الذي سأبدأ فيه الآن في وضع طبقات مختلفة من التفاصيل. والجزء التالي ، مرة أخرى ، قد يعرفه البعض منكم. لا أعتقد أنه سيكون مفهومًا أجنبيًا تمامًا. ربما تكون على دراية بهذا ، ما هي إنزيمات التقييد هذه؟ الكلمة الفعلية هي نوكلياز تقييد. غالبًا ما يطلق عليهم اسم إنزيمات التقييد في المختبر [parlons؟]. نوكلياز هو شيء يقطع الحمض النووي ، والنوكلياز الداخلي هو الذي لا يحتاج إلى نهاية مجانية. لذلك ، يمكن أن تقطع في منتصف التسلسل بدلاً من القضم في النهاية. من شأنه أن يكون نوكلياز خارجي. لذلك ، هذه الأشياء لها أسماء تميل إلى أن تكون شيئًا مثل ECO-R1 ، والتي لها علاقة بمكان اشتقاقها. والنوع النموذجي ، وهو من أوائل تلك التي لا تزال مستخدمة على نطاق واسع حقًا ، هو ECO-R1.

وهذا يتعرف على المتتالية G A T T C.

الآن ، ستلاحظ أنه إذا قرأت التسلسل بهذه الطريقة فسيكون نفس التسلسل عندما تقرأه على الشريط الآخر.

يطلق عليه اسم متناظرة ولكن كن حذرًا لأن المتناظرات في اللغة الإنجليزية ، تلك هي الكلمات التي تقرأها من الأمام إلى الخلف وهي متشابهة. في الرسالة الإنجليزية ، لا يهم ما إذا كانت مكتوبة A هنا أو A هناك.

لكنكم يا رفاق تعرفون شيئًا عن بنية الحمض النووي.

يوجد قطب من خمسة إلى ثلاثة. لذا ، فإن القراءة بهذه الطريقة لا تبدو متشابهة. الأمر مختلف تمامًا.

لكن بالقراءة في هذه السلسلة ، نقول إنها خمسة إلى ثلاثة.

الشيء المتطابق هو التسلسل المقلوب على الجانب الآخر. إذن هناك هذا ، ترى G A و G A A ولكنها ليست مثل الكلمة الإنجليزية palindrome ، لذا اختلط عليك الأمر.

على أي حال ، ما سيفعله هذا بعد ذلك ، ما يفعله هذا الإنزيم بعد ذلك ، هو أنه يقطع جانبًا هنا. يقطع بشكل متماثل.

وما يولدها هو هيدروكسيل أساسي G3.

تذكر ريبوز؟ إذا كان لدينا ، على سبيل المثال ، A هناك ، فهذه هي موضع أول ثلاثة ، وهذا هو موضع الخمسة الأولي في السكر. لذلك ، فإنه يترك ثلاثة هيدروكسيل أولي ، ثم يترك أيضًا خمسة فوسفات أولية.

إذن ، لدينا A T T C هنا ، ثم على الجانب الآخر ، سنحصل على مقلوب. إذن ، لدينا G مع ثلاثة هيدروكسيل أولي ، ثم على A T C مثل هذا.

والآن لدينا استراحة هنا. يمكننا تفكيك هؤلاء. ولكن أحد الأشياء اللطيفة التي يمكنك رؤيتها مباشرة من هذا هو أننا ننتج خمسة نهايات أساسية مفردة تقطعت بهم السبل ، وهذا هو التسلسل AATT C. كما يفعلون هنا ، سيكونون قادرين على تكوين روابط هيدروجينية. لذا ، إذا أخذت إنزيمًا مثل ECO-R1 ، وأخذنا ، دعنا نقول ، دائرة بها موقع ECO-R1 واحد ، G A T T C ، إذا قطعناه باستخدام إنزيم التقييد ، فسنقوم بعمل [nicks؟]. وإذا ظللنا نزلة برد ، فكل ما لدينا هو قطع الحمض النووي. وإذا قمنا بتسخين الأشياء قليلاً ، فهناك فقط أربعة روابط هيدروجينية تجمع ذلك معًا.

لذا ، فإن الشيء سيصبح خطيًا ويتخبط في النسيم.

إذا قمنا بتبريده ببطء ، فإن الحالة الأكثر ملاءمة من الناحية الديناميكية الحرارية ، أقل حالة طاقة ، ستكون مع عودة تلك الأطراف معًا. لذلك ، يمكننا بعد ذلك إضافة DNA ligase.

إذا أضفنا هذه المكونات وأضفنا ligase DNA ، فيمكننا عكس العملية والذهاب ذهابًا وإيابًا ، ECO-R1 لقطعها ، DNA لربطها.

ومن ثم ، فإن جمال الحمض النووي المؤتلف هو أن هذا الجزء الملتحق لا يرى ما هو موجود هنا أو ما يوجد هناك.

كل ما تراه هو الأطراف الصغيرة التي تم إنشاؤها بواسطة موقع ECO-R1.

لذلك يأخذون بعض الحمض النووي الخاص بي ، وسوف أقوم بتقطيعه.

سأحصل على زليون شظايا ECO-R1 ، لكن سيكون لديهم جميعًا نفس الشيء المتدلي الصغير الذي يكمل المتجه.

لذلك ، إذا أخذت قطعًا متجهًا باستخدام ECO-R1 ، وأخذت بعضًا من الحمض النووي الخاص بي وقمت بخلطها ، يمكنني الحصول على جزء صغير ، والدخول بين المتجه ، وهذا بالضبط ما يحدث للانضمام الذي كنت أرسمه هنا . مرة أخرى ، كان اكتشاف هذه الإنزيمات المقيدة هو الذي جعل كل الأشياء التي حدثت في علم الأحياء ممكنًا تقريبًا منذ عام 1975. كان تطوير إنزيمات التقييد أساسًا ، كنت باحثًا في مرحلة ما بعد الدكتوراة في بيركلي في تلك المرحلة والمختبرات ، ستان كوهين في ستانفورد ، و Herb Boyer في UCSF ، واثنان آخران في جميع أنحاء البلاد كانوا يعملون على هذا.كانت جميع المختبرات تقريبًا تعمل على البلازميدات البكتيرية. البلازميدات عبارة عن دوائر صغيرة من الحمض النووي ، لذا فإن المختبرات التي بدأت كانت منشغلة بدراسة دوائر صغيرة من الحمض النووي التي عادة ما تحمل مقاومة الأدوية بين الخلايا.

وهذا كان يحدث عندما كنت باحثًا في مرحلة ما بعد الدكتوراة.

وعندما وصلت إلى معهد ماساتشوستس للتكنولوجيا في عام 1976 ، كانت التكنولوجيا قد بدأت للتو.

كنت من أوائل المختبرات التي حاولت قطع أجزاء من الحمض النووي وضمها معًا مرة أخرى. لذا ، فهو تطور حديث جدًا.

في تلك المرحلة ، لم يتم اختراع تسلسل الحمض النووي.

كانت فكرة أنه يمكنك سحب قطعة من الحمض النووي والقيام بشيء ما بها أو إنتاج بروتين مجرد فكرة. لم تكن موجودة.

لذلك من الصعب المبالغة في التأكيد على مدى أهمية اكتشاف إنزيمات التقييد هذه. الآن ، أريد فقط أن أخبرك من أين أتوا ، أو كيف وجدهم الناس.

وسيحاولون القيام بذلك بسرعة لأنني أعرف أن بعضكم قد نفد صبره مع التاريخ. لكن هذا مهم حقًا لأنه من السهل جدًا الاستهزاء بالبحوث الأساسية. يمكنك أن تسخر من أي شيء بسهولة ، وقد تسأل فقط لأنني أخبرك القصة. اقترح شخص ما القيام بذلك.

سأخبرك بالتجربة التي هي أساسًا أساس صناعة التكنولوجيا الحيوية ، وهل كنت ستصبح ذكيًا بما يكفي لإدراك أنه كان اكتشاف ظاهرة تسمى التقييد ، تقييد نمو البكتيريا على البكتيريا؟

وكان ، هنا في الواقع زوجان من الكهرومغناطيسية وهذه البلازميدات الصغيرة. هذه صورة مجهرية إلكترونية.

في هذه الدوائر الصغيرة مظلل. وهذا في الواقع ملون صناعياً ، لكن هذا كان نوع البلازميدات التي كان الناس يقطعونها. لذا ، كما قلت ، محاولة المرور عبر هذا الحمض النووي ، والأشياء ، ما جعل التسلسل ممكنًا في مركز وايتهيد للجينوم والأشياء التي سأخبركم عنها مستمرة. لم أقم بإعداد هذا حقًا.

لكن هذا إيريك لاندر هو من يعلم 701 في الخريف.

لقد أخبرتك صورة من ذلك الحمض النووي الخمسين. حسنًا ، لقد أقاموا مأدبة في نهايتها ، وكنت هناك.

هذا [سافاندي بابو؟ من أوروبا الذي يقوم بترتيب تسلسل جينوم الشمبانزي. وهذا فرانسيس كولينز هو رئيس مشروع الجينوم البشري بأكمله. هذه إيفلين ويتكين ، التي كانت مكتشفًا كبيرًا لأحداث إصلاح الحمض النووي المبكرة.

ووضعت ذلك لأنه كان نوعًا ما ممتعًا.

كان هناك إريك وسافاندي ، وكان فرانسيس يتحدثان عما سيحدث عندما عرفوا تسلسل جينوم الشمبانزي ، وهو ما لم يتم. وكان هناك إعلان ، ملصق يعلن عن أحدث كتاب لجيم واتسون. ومزقوا ذلك إلى نصفين ، وكانوا يكتبون ملاحظات على الظهر طوال فترة العشاء.

لذا ، إذا كنت تريد أن ترى ما يشبه العلماء في طليعة ، بما في ذلك شخص قام بتدريس 701 الخريف ، عندما لا يقومون بتدريس 701 ، فهناك صورة.

على أي حال ، كان اكتشاف إنزيمات التقييد هو سلفادور لوريا ، الذي ذكرته. كان عضوًا في قسم الأحياء ، وأحد الفائزين بجائزة نوبل.

بدأ مركز السرطان. لقد تدرب أيضًا في Jim Watson ، عندما عرضت لك تلك الصورة. هذا سلفادور واقف هنا.

شيء آخر فعله سلفادور ، أنه كان حائزًا على جائزة نوبل لكنه فكر في علم الأحياء التمهيدي. لذلك أنا في الأساس أتبع خطى سلفادور. كتب كتابًا يسمى ، على الرغم من فوزه بجائزة نوبل ، كتاب يسمى 36 محاضرة في علم الأحياء التمهيدي. وفي بعض الجامعات ، يتم تدريس مقدمة علم الأحياء من قبل أي شخص موجود في أسفل السلسلة الغذائية. يتعثر معظم الأستاذ المبتدئ في مقدمة علم الأحياء.

وها هي الطريقة الأخرى. أعني أنك تجعل إريك وبوب ، على سبيل المثال ، واينبرغ للتدريس في الخريف ، يخبرك بذلك.

وحقاً من أين يأتي ذلك هو حقيقة أن سلفادور لوريا كان لديه مثل هذا الاهتمام في التكرار. لذلك تدرب في جيم واتسون ، وبدأ مركز السرطان هنا ، ونفذ أيضًا ظاهرة التقييد هذه. وللحصول على هذا العمل مع العاثية. وأنا أعرف [زوجين كتب؟

، لم يكن يحب رؤية كبار السن على الشرفات. لذلك شعرت بالذهول ، والتقطت هذه الصورة التالية لهذا الصباح. أوه ، يجب أن أعرضها على أي حال لسببين. هذا هو سلفادور جالس على شرفة في كولد سبرينج هاربور مع ماكس ديلبروك الذي بدأ ، حقًا ، الكثير من العمل على العاثيات التي أعطتنا أسس علم الأحياء الدقيقة. ثم ضعها جزئيًا على A لأنها تُظهر الطابع غير الرسمي لثقافة البيولوجيا الجزيئية التي استمرت حتى يومنا هذا ، وأيضًا لأن سلفادور كان لديه مثل هذا الإحساس الفكاهي. كنت ستتمتع حقًا لو كان يدرس هذه الدورة. على أي حال ، كان سلفادور يدرس هذه العاثية. تذكر أننا تحدثنا عن ذلك؟

وهم اساسا [مع حقنة؟ قاموا بحقن حمضهم النووي في الخلية. هناك صورة مجهرية الكترونية. الحمض النووي موجود في الأعلى هناك.

يدخل ، ثم يسيطر الحمض النووي على الخلية ، ويعيد برمجتها ، ويصنع طفلاً. وأريتك كيف نصنع اللوحات.

هذا ما كان يدرسه سلفادور. وهو يشبه إلى حد ما ما نتحدث عنه مع مندل. لم يكن لديه الكثير من التقنيات المتاحة له في ذلك الوقت. لم يستطع تسلسل الحمض النووي.

لم يستطع فعل الكثير من الأشياء. لكنه يستطيع [لوحة العاثية؟

وعد ، وأشياء من هذا القبيل. وما كان ينظر إليه سلفادور ، كان لديه عاثية ، ولديه سلالتان من البكتيريا.

سأسميهم A و B. حسنًا ، هنا تأتي التجربة التي أسست صناعة التكنولوجيا الحيوية. هل انت مستعد؟ هل ستمولني؟

حسنًا ، ما أقترح القيام به هو أنني سأقوم بتنمية العاثية على السلالة A ، والآن سأقوم بالتركيز على السلالة A والسلالة B.

استلقيت مستيقظًا طوال الأسبوع الماضي وأنا أفكر في هذه التجربة.

إذن ماذا حصلت؟ لقد حصلت على الكثير من اللويحات على السلالة A ، ربما شيء مثل 109 أو 1010 لكل مل لأن هذا ما يبدو عليه عادةً محلول الملتهمة بمجرد نموها.

وإذا قمت بتثبيتها على السلالة B ، فلا عاثية ، ربما لاقمات عرضية. لذلك ، أنا بخشونة يمكن أن تنمو العاثية على سلالة A. لا يمكنها النمو على السلالة B معظم الوقت ، لكن بعض المتغيرات تمكنت من معرفة كيفية النمو على السلالة B. منكم ، ربما كما أظن أن سلفادور فعل ذلك الوقت ، تغيرت الأشياء. تعلمت. لقد أحدثت بعض التغييرات في جينوماتها مما سمح لها بالنمو على السلالة B. لذا ، أتساءل عما إذا كانت قد تعلمت أن تنمو على السلالة B ، ولم تستطع النمو على السلالة A؟ لذلك ، كان ما أخذه أساسًا هو العاثية من تلك التجربة ، ثم قام بتثبيتها على السلالة A والسلالة B. وكذلك ، كما قد تتخيل ، نظرًا لأنها كانت تنمو على السلالة B ، كان هناك الكثير من اللويحات ، وكان هناك الكثير من اللوحات هنا. حسنًا ، لذلك لم ينس كيف ينمو على السلالة أ. لذا ، تحقق بشكل أفضل هنا ، أيضًا ، تحتاج إلى تجربة تحكم ، لذا خذ هذا الرجل ، وقم بإخراجه ، وسلالة A ، وسلالة B ، وبعض اللويحات هنا.

هذه ليست مفاجأة في سلالة A.

لقد عدنا إلى حيث بدأنا. لا يبدو وكأنه متحولة ، أليس كذلك؟ وإذا كانت طفرة ، كان يجب أن يكون الجميع متشابهين.

بدلًا من ذلك ، عندما نمت العاثية على السلالة A ، لم يكن لديها القدرة على النمو على السلالة B. ولكن إذا منحتها فرصة للنمو على السلالة B ، فلن يتمكن معظمهم من ذلك.

ولكن إذا حدث ذلك ، فقد اكتسب الآن القدرة على النمو على السلالة B. لذلك لا يزال بإمكانه النمو على كلا السلالة.

لكن إذا أخذت شخصًا كان ينمو ، كان هناك شيء ما ينمو عند السلالة أ ، فقده. وهكذا ، كانت الفكرة آنذاك أنها لم تكن طفرة. كان هناك شيء ما يحدث في السلالة B مكنها من النمو على السلالة B.

وإذا ابتعدت يومًا عن تلك البيئة ، [أليس كذلك؟

فقده. لذلك ، كانت تسمى هذه الظاهرة التقييد.

لم تكن طفرة. كان شيئا آخر.

واتضح ، إذن ، أن هذا التقييد كان بسبب إنزيم. مثال على هذا النوع من الأشياء ، سيكون نشاط ECO-R1 هذا القادر على القطع في تسلسل محدد للغاية. الآن ، إذا كان لديك مجموعة من المقصات الجزيئية بداخلك والتي يمكن أن تقطع متواليات G A T C ، فستواجه مشكلة ما لم تفعل شيئًا آخر لأن كل تسلسل G A T C الخاص بك سيتم قطعه بواسطة إنزيمات التقييد.

إذن ما تمتلكه الخلايا التي تحتوي على إنزيم مقيد ، كإنزيم تعديل يتعرف على نفس التسلسل ، ثم يعدله بطريقة تجعله مقاومًا لإنزيم التقييد. وفي حالة ECO-R1 ، فإنه يضع مجموعة ميثيل على هذا A. ربما كنت تعتقد أن ذلك من شأنه أن يتداخل مع الاقتران الأساسي ، لكن هذا لا يحدث لأن الأدينين يبدو هكذا. هؤلاء هم الأشخاص الذين يقومون بتكرير زوج القاعدة ، إذا نظرت إلى الوراء ، وسترى أنه يمكنك وضع مجموعة ميثيل هناك. لن يتداخل مع الاقتران الأساسي ، لكنه سيسمح بذلك. لذلك ، كان اكتشاف ظاهرة تقييد العاثية نمت على سلالة واحدة ، وليس على سلالة أخرى. يمكن أن يتعلم كيف ينمو على السلالة الأخرى.

يمكن أن تفقد هذا الاستحواذ. كانت تلك الظاهرة. الناس ، لم يكن لديهم أي سبب آخر غير أنها كانت مشكلة مثيرة للاهتمام في علم الأحياء لفهمها. بمجرد أن فهموا أساسها ، انفتح عالم آخر كامل لأنك تستطيع أن ترى من المبادئ الأساسية ، الآن يمكنني قطع أي قطعة من الحمض النووي. يمكنني إنشاء هذه النهايات اللاصقة المتدلية الصغيرة. يمكنني أن آخذ بلازميد.

عرف الناس عن هؤلاء. يمكنني العثور على موقع واحد فقط يحتوي على موقع تقييد واحد. يمكنني لصق الأشياء.

لقد قمت الآن بإرفاق أصل النسخ المتماثل لكل قطعة من هذه القطع.

وأنا في العمل. يمكنني الآن ، ولأول مرة على الإطلاق ، أخذ قطعة معينة من الحمض النووي وعمل العديد من النسخ كما أريد.

وكان ذلك تحولًا مطلقًا للطريقة التي كان بها الناس قادرين على التفكير في علم الأحياء. لذلك سأعطيكم فكرة عن كيف سيبدأ الناس. لذا فإن الطريقة التي بدأ بها الناس معظم الأشياء وما زالوا يسمونها ، المصطلح المعتاد هو أنك تسمي بناء مكتبة الحمض النووي المؤتلف.

وهناك العديد من الطرق المختلفة للقيام بذلك.

لكن هذا المبدأ هو نفسه. سنأخذ الحمض النووي من أي كائن حي تهتم به ، [وتدرس؟].

ونقطعها ببعض إنزيم التقييد. وسيقطع إنزيم التقييد هذا أينما كان هناك مواقع. قد يكونان قريبين من بعضهما البعض. قد يكونون متباعدين. ولكن مهما يكن ، لا يزال يولد مجموعة مميزة من الأجزاء. ولدينا الآن ، في هذه الحالة ، الجزء الأول ، والجزء الثاني ، والجزء الثالث ، والجزء الرابع ، وهكذا. وإذا كان هذا هو الحمض النووي الخاص بي ، فهناك الكثير من الشظايا. وبالطبع ، كلهم ​​مختلطون.

لا أستطيع تحديد مكان أي منهم. لقد تم خلطهم جميعًا معًا في أنبوب الاختبار. ثم سنأخذ المتجه الذي فتحناه. والآن ، سنمزج كل هذه الأجزاء مع هذا المتجه. ومن ثم ننضم إليها بالطريقة [التي يتم قطعها؟ . والآن ما سنحصل عليه ، هو مجموعة من البلازميدات ذات مدخلات مختلفة.

إذن ، أحد البلازميدات سيكون له ذلك الجزء رقم واحد.

واحد آخر منهم سيكون لديه الجزء الثاني ، رقم ثلاثة ، وهكذا. إذن هذا الأمر برمته هو ما يُعرف بالمكتبة. يمكنك أن ترى ما إذا كان الحمض النووي مني ، كان هناك 3 مليارات زوج قاعدي للبدء. بالنظر إلى الحمض النووي البشري ، فإن تسلسلات G A T C شائعة جدًا. يمكنك حساب التكرار بنفسك لعدد المواقع في المتوسط ​​التي يمكن أن يكون هناك إنزيم مقيد داخل قطعة من الحمض النووي ومعرفة تقريبًا كيف ستكون الأجزاء الموجودة في مكتبة الحمض النووي البشري.

لذلك ، نحن جزء من الطريق هناك. يمكننا الآن إنشاء مكتبة.

يمكننا صنعه من الحمض النووي البكتيري. يمكننا صنعه من الحمض النووي البشري. لكن الشيء التالي الذي يجب أن يتعلمه الناس هو معرفة كيفية العثور على جزء معين يحتوي على الجين الذي تهتم به. وهناك مجموعة كاملة من الأشياء. أعني ، في نهاية المطاف اليوم منذ أن تم تسلسل الجينوم البشري ، تذهب على جهاز كمبيوتر ونوع وتجده لأن التسلسل معروف تمامًا. لكن السبب الوحيد الذي يمكننا من القيام بذلك هو بسبب كل العمل الذي تم القيام به بينهما.

لذا ، سأعطيك عدة طرق للقيام بذلك. لكن إحدى الطرق التي أعتقد أنه يمكنك رؤيتها بسهولة شديدة ، وهي في الواقع تعود إلى مصطلح التكملة. تذكر التكملة؟

كان لدينا شيء متحور ، ثم وضعنا جينًا من النوع البري ، وأصلحناه مرة أخرى. لذلك ، على سبيل المثال ، افترض أنني كنت أدرس التخليق الحيوي للهستيدين في بكتيريا E.

coli ، وأردت العثور على الجين الذي يشفر الإنزيم الذي قمت بتعطيله للتو في الهيستدين ناقص متحولة. لذا ، إذا كان لدي [hisoxotroph؟] ، فسأطلق عليه [صاحب G؟

الجين ، على سبيل المثال ، هو أحد الجينات المشاركة في صنع الهيستيدين. لذلك ، نظرًا لأنه أكسوتروف هيستيدين ، إذا كان لدي فقط الحد الأدنى من لوحات الجلوكوز ، وقمت بتقطيعه ، فلن ينمو. ولكن إذا قمت بزراعته باستخدام الحد الأدنى من الجلوكوز بالإضافة إلى الهيستيدين ، فسيكون قادرًا على النمو ، أليس كذلك؟ لذا ، لدي نوع مختلف من هذا الكائن الحي.

لديها طفرة واحدة تؤثر على جين واحد.

ولأنني لا أملك هذا الجين ، لا يمكنني أن أنمو عند الحد الأدنى.

إذا أنشأت مكتبة من E. coli DNA ، والتي ستحتوي على الكثير من الأجزاء أيضًا ، وأخذت تلك المكتبة ووضعتها في هذه المتحولة ، سأحصل على فوضى كبيرة في الأشياء ، كل بلازميدات مختلفة مع كل الأجزاء المختلفة التي تدخل في ذلك الطافرة. كيف سأجد الشخص الذي أريده؟ هل يرى أحد ذلك؟ إنها ليست بتلك الصعوبة. أنا المتحولة.

لا أستطيع أن أنمو عند الحد الأدنى لأنني لا أستطيع صنع هذا الإنزيم.

لذلك ، لا يمكنني صنع الهيستيدين. ماذا احتاج؟ كيف يمكن أن تصلحني إذا كنت طبيبا؟ ما هو الجين الذي نريده من هنا؟

الذي يصنع هذا الإنزيم المعين الذي يصنع الهيستيدين.

نعم ، خذ المكتبة بأكملها ، ألصقها في هذا المتحولة. إذا كان الجين القادم يشفر DNA polymerase ، فلن أساعد هذا الرجل. لا يزال غير قادر على النمو في الحد الأدنى ، فإن الجين المتورط في تكوين جزء من جدار الخلية سيساعد.

لكن إذا أدخلت ، حصلت على جزء من الحمض النووي يتضمن جين G plus الخاص به ، ووضعته هنا ، فسوف يكبر. إذا كان يحتوي على البلازميد الذي يحتوي ، أو دعنا نقول المتجه الذي يحتوي على جين G plus الخاص به.

إذن ما فعلته هو نوعًا ما ، لقد استخدمت مبدأ التكملة الذي كان بعضكم يتساءل عنه نوعًا ما عندما كنا نقوم بعلم الوراثة. لذا ، يمكنك كسر نسخة من الجين.

في الأشياء التي تحدثنا عنها ، نحضر كروموسومًا كاملاً يشتمل فيه فقط على نسخة من النوع البري من الجين. مع الحمض النووي المؤتلف ، يمكننا حقًا تضييقه إلى أقصى الحدود. يمكننا إحضار قطعة من الحمض النووي ليست سوى الجين المكسور.

ويمكننا إعادة الجين إلى النوع البري. شيء واحد ، فقط للإغلاق ، سترى ، إذا تذكرت مرة أخرى عندما تحدثت عن لغة ليست عالمية ، على الرغم من أن الشفرة الجينية عالمية ، فإن المروجين والأشياء ليست كذلك. لذلك لم أستطع فعل ذلك أبدًا باستخدام الحمض النووي البشري ، هل يمكنني ذلك ، لأنه لن يتم التعبير عنه. لذلك ، نحن بحاجة إلى بعض الطرق الأخرى للعثور عليها. سنتحدث عن هؤلاء في المحاضرة القادمة ، حسنًا؟


الحمض النووي المؤتلف: فهم الصف التاسع لبيولوجيا IGCSE 5.12 5.13 5.14

في المنشور الأخير حول هذا الموضوع ، شرحت نوعين من الإنزيمات اللازمة للتعديل الجيني للكائنات الحية:

أنزيمات التقييد يمكن أن تقطع جزيئات الحمض النووي في تسلسلات مستهدفة محددة ، مما يؤدي غالبًا إلى شظايا ذات نهايات لزجة

ligase DNA التي تجمع الشظايا معًا لتشكيل جزيء DNA واحد

يستخدم منهج EdExcel iGCSE مثال التعديل الجيني للبكتيريا لإنتاج الأنسولين البشري. الأنسولين البشري هو هرمون يساعد على تنظيم تركيز الجلوكوز في الدم. يتم تصنيعه في البنكرياس عندما يرتفع تركيز الجلوكوز في الدم بشكل كبير ويؤدي إلى امتصاص خلايا الكبد للجلوكوز من الدم وتحويله إلى جزيء تخزين الجليكوجين. لا يستطيع مرضى السكري من النوع الأول صنع الأنسولين بأنفسهم ولذا يحتاجون إلى حقنه عدة مرات في اليوم بعد الوجبات لضمان الحفاظ على تركيز صحي ثابت للجلوكوز في دمائهم.

يمكن تعديل البكتيريا وراثيًا بحيث تنتج الأنسولين البشري. يمكن استنبات هذه البكتيريا المعدلة وراثيا في المخمر ويمكن استخراج الأنسولين المنتج وتنقيته وبيعه.

كيف تحصل على جين الأنسولين البشري؟

حسنًا ، الإجابة الصادقة هي أن هناك طرقًا متنوعة لتحقيق ذلك. يمكن الآن تصنيعه بشكل مصطنع لأننا نعرف التسلسل الأساسي الدقيق للجين ولكن يمكن أيضًا قطعه من مكتبة الحمض النووي البشري باستخدام إنزيم التقييد. هناك طرق أخرى أيضًا ولكن من أجل الإيجاز (والعقلانية) لن أخوض فيها هنا. [إذا كنت مهتمًا حقًا بهذا ، اكتشف كيف يمكن أن يسمح لك النسخ العكسي للحمض النووي الريبي من خلايا البنكرياس ببناء جين الأنسولين.]

كيف تحصل على جين الأنسولين البشري في بكتيريا؟

تذكر أن الخلايا البكتيرية تختلف اختلافًا جوهريًا عن الخلايا الحيوانية والنباتية. أحد الاختلافات هو أن الخلايا البكتيرية ليس لها نواة وأن الحمض النووي الخاص بها يكون على شكل حلقة تطفو في السيتوبلازم. تحتوي العديد من البكتيريا أيضًا على بلازميدات وهي عبارة عن حلقات إضافية صغيرة من الحمض النووي وهذه توفر طريقة للحصول على جين جديد في البكتيريا.

تقوم البكتيريا بتبادل البلازميدات في عملية تسمى الاقتران وبالتالي من السهل جدًا إخراج البلازميد من البكتيريا. إذا تم قطع البلازميد فتح باستخدام نفس إنزيم التقييد كما تم استخدامه لقطع جين الأنسولين البشري ، فإن الأطراف اللاصقة سوف تتطابق وبالتالي فإن DNA ligase سينضم إلى قطعتين من الحمض النووي معًا لصنع المؤتلف البلازميد. يوضح الرسم البياني أدناه عملية هرمون النمو البشري ولكنها ستكون هي نفسها تمامًا بالنسبة للمثال الذي ننظر إليه.

إذا تم إدخال البلازميدات المؤتلفة في البكتيريا ، فسوف تقرأ البكتيريا جين الأنسولين البشري وبالتالي تنتج بروتين الأنسولين.

كيف تزرع البكتيريا المعدلة وراثيا على نطاق صناعي؟

تزرع البكتيريا التي تناولت البلازميد المؤتلف في أ المخمر. هذا وعاء كبير من الفولاذ المقاوم للصدأ (سهل التنظيف والتعقيم) وغالبًا ما يحتوي على العديد من ميزات التصميم المحفوظة بين الأنواع المختلفة:

عادة ما يكون للمخمر ملف سترة التبريد لحمل الحرارة الزائدة. غالبًا ما يحتوي الغلاف على أنبوب إدخال الماء البارد ويتم نقل الماء الأكثر دفئًا بعيدًا. يجب أن تكون هناك آلية ما ل خلط محتويات جهاز التخمير لذا فإن الرسم البياني أعلاه يوضح المجاذيف المتصلة بالمحرك. المخمرون بحاجة أيضا مدخلات معقمة نظام لإدخال الهواء والماء والمغذيات إلى المخمر ولكن دون إدخال البكتيريا والفطريات الغريبة. الهواء ضروري لأن البكتيريا هوائية وتحتاج إلى الأكسجين للتنفس.

إذا كانت البكتيريا الموجودة في المخمر تحتوي على جين الأنسولين البشري ، فستكون قادرة على إنتاج الأنسولين البشري. يمكن استخراجها وتنقيتها وبيعها إلى NHS لعلاج مرضى السكري من النوع الأول.


تقييد الحمض النووي

إن اكتشاف الإنزيمات التي يمكنها قطع ولصق الحمض النووي جعل الهندسة الوراثية ممكنة. يمكن استخدام إنزيمات التقييد ، الموجودة بشكل طبيعي في البكتيريا ، لقطع شظايا الحمض النووي في تسلسلات محددة ، في حين أن إنزيم آخر ، وهو DNA ligase ، يمكن أن يعلق أو يعيد ضم أجزاء من الحمض النووي ذات النهايات التكميلية.

هذه الرسوم المتحركة متاحة أيضًا على شكل فيديو.

إن اكتشاف الإنزيمات التي يمكنها قطع ولصق الحمض النووي جعل الهندسة الوراثية ممكنة. يمكن استخدام إنزيمات التقييد ، الموجودة بشكل طبيعي في البكتيريا ، لقطع شظايا الحمض النووي في تسلسلات محددة ، في حين أن إنزيم آخر ، وهو DNA ligase ، يمكن أن يعلق أو يعيد ضم أجزاء من الحمض النووي ذات النهايات التكميلية.

ليجاس الحمض النووي ، شظايا الحمض النووي ، الإنزيمات المقيدة ، الهندسة الوراثية ، البكتيريا ، المتواليات ، الاكتشاف


ماذا يحدث إذا قمنا بحقن إنزيم تقييد في الدم - علم الأحياء

هل أنت متأكد؟

لا يمكن التراجع عن هذا الإجراء. سيؤدي هذا إلى حذف جميع الأسئلة التي تمت ممارستها بشكل دائم.

هل أنت متأكد؟

لا يمكن التراجع عن هذا الإجراء. سيؤدي هذا إلى حذف جميع الأسئلة التي تمت ممارستها بشكل دائم.

اضف ملاحظة

لفتح جميع الشروحات المكونة من 38 فصلاً ، يجب أن تكون مسجلاً في دورة MasterClass.

أود أن أعرف أكثر من ذلك

اضف ملاحظة
اضف ملاحظة
اضف ملاحظة

(1) B هو ابن A و C.

(2) C هو ابن A و B.

(3) D هو ابن B و C.

(4) A هو ابن B و C.

اضف ملاحظة
اضف ملاحظة

لفتح جميع الشروحات المكونة من 38 فصلاً ، يجب أن تكون مسجلاً في دورة MasterClass.

أود أن أعرف أكثر من ذلك

اضف ملاحظة

لفتح جميع الشروحات المكونة من 38 فصلاً ، يجب أن تكون مسجلاً في دورة MasterClass.

أود أن أعرف أكثر من ذلك

يتم خلط مستخلص المكورات العقدية المقتولة بالحرارة والمعالج بالبروتياز مع خلايا المكورات العقدية الحية على شكل R ويتم حقنها في الفئران الحية. ما هو الأكثر احتمالا أن يحدث؟
1. ستعيش الفئران.
2. سوف تموت الفئران.
3. دم الفئران يحتوي على خلايا R ميتة
4. سلالة جديدة من المكورات العقدية ستكون موجودة في الفئران.

اضف ملاحظة

لفتح جميع الشروحات المكونة من 38 فصلاً ، يجب أن تكون مسجلاً في دورة MasterClass.

أود أن أعرف أكثر من ذلك

إن إضافة ديوكسي ريبونوكليوتيدات بواسطة بوليميراز الحمض النووي أثناء تخليق الحمض النووي هي عملية إندرجونيك. مصدر الطاقة المستخدمة هو:
1. ATP.
2. الطاقة من فوتونات الضوء.
3. الانتروبيا الناتجة عن هضم البروتين.
4. النيوكليوتيدات نفسها

اضف ملاحظة

لفتح جميع الشروحات المكونة من 38 فصلاً ، يجب أن تكون مسجلاً في دورة MasterClass.

أود أن أعرف أكثر من ذلك

يُعتقد أن جميع الكائنات الحية قد نشأت من سلف واحد بعيد. أقوى دليل على ذلك سيكون:
1. يخزن الحمض النووي المعلومات الجينية في جميع الكائنات الحية.
2. الشيفرة الجينية هي رمز ثلاثي بشكل عام.
3. إن الأحماض الأمينية المحددة بواسطة ثلاثة توائم معينة تكون دائمًا متطابقة تقريبًا بين أي كائنين.
4. الشيفرة الجينية متدهورة ولكنها لا لبس فيها.


الحمض النووي المؤتلف: فهم الصف التاسع لبيولوجيا IGCSE 5.12 5.13 5.14

في المنشور الأخير حول هذا الموضوع ، شرحت نوعين من الإنزيمات اللازمة للتعديل الجيني للكائنات الحية:

أنزيمات التقييد يمكن أن تقطع جزيئات الحمض النووي في تسلسلات مستهدفة محددة ، مما يؤدي غالبًا إلى شظايا ذات نهايات لزجة

ligase DNA التي تجمع الشظايا معًا لتشكيل جزيء DNA واحد

يستخدم منهج EdExcel iGCSE مثال التعديل الجيني للبكتيريا لإنتاج الأنسولين البشري. الأنسولين البشري هو هرمون يساعد على تنظيم تركيز الجلوكوز في الدم. يتم تصنيعه في البنكرياس عندما يرتفع تركيز الجلوكوز في الدم بشكل كبير ويؤدي إلى امتصاص خلايا الكبد للجلوكوز من الدم وتحويله إلى جزيء تخزين الجليكوجين. لا يستطيع مرضى السكري من النوع الأول صنع الأنسولين بأنفسهم ولذا يحتاجون إلى حقنه عدة مرات في اليوم بعد الوجبات لضمان الحفاظ على تركيز صحي ثابت للجلوكوز في دمائهم.

يمكن تعديل البكتيريا وراثيًا بحيث تنتج الأنسولين البشري. يمكن استنبات هذه البكتيريا المعدلة وراثيا في المخمر ويمكن استخراج الأنسولين المنتج وتنقيته وبيعه.

كيف تحصل على جين الأنسولين البشري؟

حسنًا ، الإجابة الصادقة هي أن هناك طرقًا متنوعة لتحقيق ذلك. يمكن الآن تصنيعه بشكل مصطنع لأننا نعرف التسلسل الأساسي الدقيق للجين ولكن يمكن أيضًا قطعه من مكتبة الحمض النووي البشري باستخدام إنزيم التقييد. هناك طرق أخرى أيضًا ولكن من أجل الإيجاز (والعقلانية) لن أخوض فيها هنا. [إذا كنت مهتمًا حقًا بهذا ، اكتشف كيف يمكن أن يسمح لك النسخ العكسي للحمض النووي الريبي من خلايا البنكرياس ببناء جين الأنسولين.]

كيف تحصل على جين الأنسولين البشري في بكتيريا؟

تذكر أن الخلايا البكتيرية تختلف اختلافًا جوهريًا عن الخلايا الحيوانية والنباتية. أحد الاختلافات هو أن الخلايا البكتيرية ليس لها نواة وأن الحمض النووي الخاص بها يكون على شكل حلقة تطفو في السيتوبلازم. تحتوي العديد من البكتيريا أيضًا على بلازميدات وهي عبارة عن حلقات إضافية صغيرة من الحمض النووي وهذه توفر طريقة للحصول على جين جديد في البكتيريا.

تقوم البكتيريا بتبادل البلازميدات في عملية تسمى الاقتران وبالتالي من السهل جدًا إخراج البلازميد من البكتيريا. إذا تم قطع البلازميد فتح باستخدام نفس إنزيم التقييد كما تم استخدامه لقطع جين الأنسولين البشري ، فإن الأطراف اللاصقة سوف تتطابق وبالتالي فإن DNA ligase سينضم إلى قطعتين من الحمض النووي معًا لصنع المؤتلف البلازميد. يوضح الرسم البياني أدناه عملية هرمون النمو البشري ولكنها ستكون هي نفسها تمامًا بالنسبة للمثال الذي ننظر إليه.

إذا تم إدخال البلازميدات المؤتلفة في البكتيريا ، فسوف تقرأ البكتيريا جين الأنسولين البشري وبالتالي تنتج بروتين الأنسولين.

كيف تزرع البكتيريا المعدلة وراثيا على نطاق صناعي؟

تزرع البكتيريا التي تناولت البلازميد المؤتلف في أ المخمر. هذا وعاء كبير من الفولاذ المقاوم للصدأ (سهل التنظيف والتعقيم) وغالبًا ما يحتوي على العديد من ميزات التصميم المحفوظة بين الأنواع المختلفة:

عادة ما يكون للمخمر ملف سترة التبريد لحمل الحرارة الزائدة. غالبًا ما يحتوي الغلاف على أنبوب إدخال الماء البارد ويتم نقل الماء الأكثر دفئًا بعيدًا. يجب أن تكون هناك آلية ما ل خلط محتويات جهاز التخمير لذا فإن الرسم البياني أعلاه يوضح المجاذيف المتصلة بالمحرك. المخمرون بحاجة أيضا مدخلات معقمة نظام لإدخال الهواء والماء والمغذيات إلى المخمر ولكن دون إدخال البكتيريا والفطريات الغريبة. الهواء ضروري لأن البكتيريا هوائية وتحتاج إلى الأكسجين للتنفس.

إذا كانت البكتيريا الموجودة في المخمر تحتوي على جين الأنسولين البشري ، فستكون قادرة على إنتاج الأنسولين البشري. يمكن استخراجها وتنقيتها وبيعها إلى NHS لعلاج مرضى السكري من النوع الأول.


معلومات تكميلية

يحتوي هذا الملف على الأشكال التكميلية 1-11 والجدول التكميلي 1 والأساطير للأفلام التكميلية 1-3. (PDF 1937 كيلوبايت)

فيلم تكميلي 1

يعرض هذا الفيلم حركة خلايا الدم الحمراء عبر الأوعية الدموية في أجنة من النوع البري. (MOV 707 كيلوبايت)

فيلم تكميلي 2

يعرض هذا الفيلم حركة خلايا الدم الحمراء عبر الأوعية الدموية في الأجنة المحقونة بـ cdh5 MO. (MOV 1831 كيلوبايت)

فيلم تكميلي 3

يعرض هذا الفيلم حركة خلايا الدم الحمراء عبر الأوعية الدموية في الأجنة المحقونة بـ cdh5 GoldyTALEN. (MOV 89 كيلوبايت)


ماذا يحدث إذا قمنا بحقن إنزيم تقييد في الدم - علم الأحياء

هل أنت متأكد؟

لا يمكن التراجع عن هذا الإجراء. سيؤدي هذا إلى حذف جميع الأسئلة التي تمت ممارستها بشكل دائم.

هل أنت متأكد؟

لا يمكن التراجع عن هذا الإجراء. سيؤدي هذا إلى حذف جميع الأسئلة التي تمت ممارستها بشكل دائم.

اضف ملاحظة

لفتح جميع الشروحات المكونة من 38 فصلاً ، يجب أن تكون مسجلاً في دورة MasterClass.

أود أن أعرف أكثر من ذلك

اضف ملاحظة
اضف ملاحظة
اضف ملاحظة

(1) B هو ابن A و C.

(2) C هو ابن A و B.

(3) D هو ابن B و C.

(4) A هو ابن B و C.

اضف ملاحظة
اضف ملاحظة

لفتح جميع الشروحات المكونة من 38 فصلاً ، يجب أن تكون مسجلاً في دورة MasterClass.

أود أن أعرف أكثر من ذلك

اضف ملاحظة

لفتح جميع الشروحات المكونة من 38 فصلاً ، يجب أن تكون مسجلاً في دورة MasterClass.

أود أن أعرف أكثر من ذلك

يتم خلط مستخلص المكورات العقدية المقتولة بالحرارة والمعالج بالبروتياز مع خلايا المكورات العقدية الحية على شكل R ويتم حقنها في الفئران الحية. ما هو الأكثر احتمالا أن يحدث؟
1. ستعيش الفئران.
2. سوف تموت الفئران.
3. دم الفئران يحتوي على خلايا R ميتة
4. سلالة جديدة من المكورات العقدية ستكون موجودة في الفئران.

اضف ملاحظة

لفتح جميع الشروحات المكونة من 38 فصلاً ، يجب أن تكون مسجلاً في دورة MasterClass.

أود أن أعرف أكثر من ذلك

إن إضافة ديوكسي ريبونوكليوتيدات بواسطة بوليميراز الحمض النووي أثناء تخليق الحمض النووي هي عملية إندرجونيك. مصدر الطاقة المستخدمة هو:
1. ATP.
2. الطاقة من فوتونات الضوء.
3. الانتروبيا الناتجة عن هضم البروتين.
4. النيوكليوتيدات نفسها

اضف ملاحظة

لفتح جميع الشروحات المكونة من 38 فصلاً ، يجب أن تكون مسجلاً في دورة MasterClass.

أود أن أعرف أكثر من ذلك

يُعتقد أن جميع الكائنات الحية قد نشأت من سلف واحد بعيد. أقوى دليل على ذلك سيكون:
1. يخزن الحمض النووي المعلومات الجينية في جميع الكائنات الحية.
2. الشيفرة الجينية هي رمز ثلاثي بشكل عام.
3. إن الأحماض الأمينية المحددة بواسطة ثلاثة توائم معينة تكون دائمًا متطابقة تقريبًا بين أي كائنين.
4. الشيفرة الجينية متدهورة ولكنها لا لبس فيها.


علم الأحياء الدقيقة 101 نص الإنترنت

ما هي الأدوات الأساسية لشركة GE وكيف تعمل وكيف تعمل.

كيف يتم إجراء استنساخ الجينات.

كيف يمكن استخدام الحمض النووي لتحديد جميع الكائنات الحية

كيف يمكننا اكتشاف الكميات الصغيرة جدًا من الحمض النووي حتى عندما يكون عمرها ملايين السنين.

بالإضافة إلى ذلك ، سيتم عرض المشكلات الأخلاقية لثورة جنرال إلكتريك ودراسة بعض الطرق الممكنة للتعامل معها.

وصف البيولوجيا الجزيئية

لقد قمت بإدراج بعض التغييرات التي قد تواجهها في حياتك ، وبعضها في الواقع خلال السنوات القليلة المقبلة. مع التسلسل الكامل للجينوم البشري المتوقع في مطلع القرن ، سيتم فتح مجموعة جديدة كاملة من الاحتمالات. حاليًا (خريف 1996) قمنا بتسلسل> 10000 من

100000 جين بشري ، ومعدل التسلسل يتسارع مع تحسين تقنيات التسلسل. حوالي 3000 مرض وراثي بشري معروف حاليًا. وهذا يعني أن ما يقرب من 14٪ من الأطفال حديثي الولادة مصابون بمرض وراثي "مرئي". لا يبدأ هذا في تضمين "الميول" الجينية (للإصابة بالسرطان والتهاب المفاصل والسل ونزلات البرد والربو والإنفلونزا وما إلى ذلك) و / أو "الحالات" التي لدينا جميعًا ما هي الحالات الجينية التي لديك؟ على سبيل المثال ، أنا وأخي غير الشقيق نعاني من حالة وراثية تسمى Celiac Sprue ، مما يعني أن بروتين القمح (الغلوتين) يتسبب في أشياء سيئة لخلايا الأمعاء ولا يمكننا تناول البيتزا وما إلى ذلك. لأننا لا نأكل منتجات القمح. Sprue هي "حالة" وراثية شائعة تؤثر على ما يصل إلى 25٪ من الأيرلنديين والأعداد الأقل من المجموعات العرقية الأخرى. كم عدد قراءة هذا الايرلندي؟ يعاني بعضكم من الحساسية وقصر النظر والصداع النصفي وما إلى ذلك ، وكلها لها أساس في الجينوم الخاص بك. بمجرد تعيين الجينوم البشري ، لا يمكننا فقط تحديد الأليلات المعينة التي يمتلكها كل منا ، ولكن في النهاية سنكتشف طريقة لاستبدال "الجينات غير المرغوب فيها" بـ "الجينات الجيدة".

سؤال للتفكير النقدي: كيف يمكننا كأفراد وكمجتمع تعريف الجينات "الجيدة والسيئة"؟ على سبيل المثال ، إذا اتضح أن الجينات هي أساس إدمان الكحول أو المثلية الجنسية أو التحرش بالأطفال أو الاكتئاب الهوسي ، فهل نبدأ في "علاج" الأشخاص من هذه الجينات؟ إذا تم العثور على جين "مثلي الجنس" ، فماذا ستفعل إذا وجدت أن جنينك يحمل هذا الجين؟

تتمثل إحدى المشكلات الحالية في الثورة الجينية في أن معرفة الجين الذي يسبب حالة المرض والقدرة على تحديد وجود هذا الجين في الشخص ، لا يعني أننا نفهم البيولوجيا الجزيئية لعملية المرض ، وبالتالي لا يمكننا عادةً منع أو علاج المرض الناجم عن الجين المعيب. مثال على هذه المعضلة الرهيبة هو أنه تم اكتشاف عدد من الجينات التي تهيئ النساء للإصابة بسرطان الثدي (ويتم العثور باستمرار على جينات جديدة). هذا يثير اعتبارات أخلاقية وشخصية مهمة.

إذا كان العلاج أو المنع غير ممكن ، فهل يجب إخبار المرأة بأنها تحمل مثل هذا الجين؟

إذا لم يكن العلاج أو الوقاية ممكنًا ، فهل تريد أن تعرف أن لديك قنبلة موقوتة في داخلك؟

  • دعونا نفحص حالة أخرى من "المنطقة الرمادية" قبل أن نبدأ. الاكتئاب الهوسي (MD) هو مرض يصيب الكثير من الناس. في بعض الحالات يكون معتدلًا نسبيًا بينما في حالات أخرى يؤدي إلى خسائر فادحة ، وغالبًا ما يؤدي إلى الانتحار. يبدو أيضًا أن له أساسًا وراثيًا لأنه يسري في العائلات ، وغالبًا ما يوصم الأعضاء المتأثرين وغير المتأثرين على حد سواء. أود أن أراهن بالمال على أن معظمكم يقرأ هذا يعرف شخصًا مصابًا بالاكتئاب الهوسي ، وبالطبع بعضكم طبيب. ومع ذلك ، يمكن علاج المرض غالبًا عن طريق الأدوية الرخيصة والعلاج النفسي ، على الرغم من أن العديد من الناس يعانون من العذاب لسنوات قبل أن يتم تشخيصهم وعلاجهم بشكل صحيح. الجانب المثير للاهتمام من MD هو أن العديد من الفنانين والسياسيين المبدعين كانوا (ربما بعض السياسيين الحاليين لدينا هم MD). روبرت شومان ، اللورد بايرون ، فنسنت فان جوخ ، ونستون تشرشل وألفريد ، اللورد تينيسون جميعهم عانوا من الأعراض الكلاسيكية لطبيب الطب (انظر "مرض الاكتئاب الهوسي والإبداع" ، علوم. فبراير 1995 وأمبير 1995). بمجرد تحديد الجينات المسببة لمرض MD ، يمكننا استخدام هذه المعلومات لاتخاذ قرارات بشأن ما إذا كان يجب إنجاب أطفال مصابين بالتهاب MD أو إجهاض أي جنين يحمل هذا الجين. ماذا كنت ستفعل؟ في النهاية سنتمكن من علاج (قمع) الحالة تمامًا. هل سيؤدي تشعب هذه النتائج إلى جعل العالم أقل إثارة للاهتمام وتحفيزًا؟ ما هو رأيك؟

هل ينبغي لزميل المرء أو رئيسه أو شركة التأمين أو صاحب العمل المحتمل وما إلى ذلك الوصول إلى معلوماتك الجينية؟ هل يمكنك التفكير في مواقف يكون فيها من المنطقي والمعقول للآخرين الحصول على هذه المعلومات؟ ماذا عن الجيش؟ وكالة المخابرات المركزية؟

إذا كنت تمتلك شركة تأمين على الحياة ، فهل ستقدم تبرعاتك السياسية لعضو في الكونجرس فضل مطالبة حاملي بوليصة التأمين المحتملين بتقديم هذه المعلومات إلى شركة التأمين الخاصة بهم.

من الذي يدفع ثمن فحص الجينات المرضية التي تكلفتها مرتفعة حاليًا؟ هل يجب أن أدفع مقابل الفحص والعكس صحيح؟

ماذا لو كنت تتحكم في المعلومات الجينية وتعرف أن إعطائها سيؤدي إلى الإجهاض ، فماذا ستفعل؟

ماذا لو كان لديك وصول إلى المعلومات الجينية لشخص ما ستتزوج ابنتك / ابنك أو أختك / أخوك وما إلى ذلك ولا تعتقد أنهم أخبروه عن "حالة" وراثية خطيرة. هل تريد التحدث ؟ من يملك ولاءك؟ ما هي الأخلاق هنا؟

تذكير أخير لأي شخص يفكر في تجنب هذه المشكلات تجارب العلاج الجيني جارية حاليًا (لكنهم يواجهون مشاكل في العمل: TIME 10/9/95 Science 269: 1050 [1995]) ، يقرر الناس الإجهاض على أساس تزداد نتائج الاختبارات الجينية للجنين وعدد الجينات المعيبة المحددة يوميًا تقريبًا (وبعض الجينات التي يجدونها ستكون أنت وأنا أحملها).

تاريخ الهندسة الوراثية

في الخمسينيات من القرن الماضي ، لوحظ أنه إذا قام أحدهم بزراعة عاثية معينة على سلالة مضيفة متحولة بكتيرية معينة (A) ثم أصاب سلالة متحولة بكتيرية (B) ، من نفس النوع ، بالعاثة A ، محصول العاثية من السلالة B كانت منخفضة جدًا. ومع ذلك ، إذا أخذت عددًا قليلًا من العاثيات B التي تم إنتاجها وإصابة السلالة B بها ، فإن محصول العاثية أصبح الآن طبيعيًا. في وقت لاحق ، في الستينيات ، وجد أن الحمض النووي للعاثية الذي نما على السلالة B قد تم تعديله كيميائيًا بحيث لا يمكن شق (تدمير) بواسطة DNase في السلالة B. تم العثور على DNase المتضمن في هذا الانقسام ليكون محددًا إلى حد ما ، حيث أنه يقطع الحمض النووي بشكل أساسي في تسلسلات معينة ما لم يتم تعديل هذه التسلسلات كيميائيًا بواسطة إنزيمات في الخلية (مفقودة في السلالة A). قطعت جميع DNases السابقة الحمض النووي بشكل عشوائي ، لذلك اقترح هذا الاكتشاف أنه يمكن تقطيع الحمض النووي إلى أجزاء محددة من شأنها أن تحتوي دائمًا على نفس مجموعة الجينات بين المواقع المقطوعة. ومع ذلك ، فإن هذه DNases "المحددة" الأولى لم تثبت أنها محددة كما هو مأمول. أخيرًا ، في عام 1970 ، اكتشف هاميلتون سميث بالصدفة أن DNase من بكتيريا المستدمية النزلية ، يقطع الحمض النووي فقط في سلاسل DNA الفريدة المعروفة باسم PALINDROMIC SITES.

باليندرومز

في الحمض النووي ، يعد موقع PALINDROMIC عبارة عن سلسلة من أزواج القواعد في الحمض النووي المزدوج الذي تقطعت به السبل والذي يقرأ نفس الشيء للخلف وللأمام عبر الشريط المزدوج. على سبيل المثال ، يعتبر تسلسل أزواج القاعدة GAATTC متناظرًا لأن كلا من تسلسل الخيط المزدوج يقرؤون نفس الشيء عند القراءة من نهايتيهما "G" أو "C" (الشريط التكميلي = CTTAAG). تسمى الإنزيمات التي تقطع هذه المواقع المحددة بـ RESTRICTION ENZYMES (RE). بناءً على أنواع CUTS التي يصنعونها ، هناك نوعان من RE:

تقطع مجموعة واحدة مباشرة عبر الحمض النووي المزدوج الذي تقطعت به السبل ، مما يؤدي إلى إنتاج DNA BLUNT ENDED (الشكل 2).

نوع آخر يقطع خيط الحمض النووي خارج مركز المواقع المتناظرة ، ولكن بين قاعدتين متماثلتين على الخيوط المتقابلة. يؤدي هذا إلى ترك قاعدة أو أكثر متدلية على كل خصلة وتسمى هذه الأطراف نهايات مثبتة (الشكل 1) لأنها تشكل سندات HYDROGEN مع نظيراتها المقطوعة التكميلية.

على سبيل المثال ، في التسلسل الأساسي G A ATTC ، فإن RE الذي يقطع هذا الموقع يشق الحمض النووي بين "G" و "A" على كل خيط تكميلي ، وبالتالي يترك المتدليات من AATT و amp TTAA على التوالي (الشكل 1). تم عزل أكثر من 200 طاقة متفاعلة مختلفة تم قطعها في العديد من تسلسلات الحمض النووي المختلفة. جميعها محددة تمامًا وهذه الخصوصية هي مفتاح استخدامها. تم العثور على REs التي تقطع في 4 و 5 و 6 و 8 و 9 و 11 موقعًا متناظرًا لزوج قاعدي. ويترتب على ذلك أن أكثر الأزواج الأساسية في الموقع المتناوب أقل احتمالًا أن يكون الموقع موجودًا إحصائيًا. وهذا يعني أن RE 4-base-cut-cut يقطع الحمض النووي نفسه عدة مرات أكثر مما يفعل القاطع ذو الثماني قواعد. مواقع القطع ذات الأرقام الفردية ليست متجانسة حقيقية للحمض النووي ، حيث أن نقطة الأساس المركزية تقرأ بشكل مختلف في الاتجاهين. على سبيل المثال AA؟ TT هو موقع قطع 5 نقاط أساس ، أين؟ = عدد من القواعد المختلفة.

الشكل 1. قطع نهاية لزجة مع إنزيم التقييد. تشير الأسهم الحمراء إلى المواضع التي تقطع فيها الطاقة المتجددة الحمض النووي. عندما تسحب الحوامل التكميلية بعيدًا ، يتم ترك الأجزاء المتدلية "اللزجة".

الشكل 2. قطع نهائية بلانت بواسطة إنزيم تقييد. قطع الأطراف غير الحادة تشق الحمض النووي بين قاعدتين في منتصف موقع متناوب.

سؤال تفكير حاسم: فيما يلي أمثلة لمواقع RE DNA الموجودة على خيط واحد. أضف القواعد التكميلية وابحث عن مواقع RE: CCTAGT AATCCTAGGACG AAATTAATCGG TAAGGCGCGCCTAAT TACGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGTATCCCCGGGTACCGAGCTCGAATTCACT.

هناك 10 مواقع RE في هذا الموقع الأخير ، هل يمكنك العثور على جميع المواقع العشرة؟

المكون الأخير المهم في الهندسة الوراثية هو إنزيم يسمى LIGASE. Ligase هو إنزيم يربط تساهميًا في العمود الفقري للسكر والفوسفات في القواعد معًا. يشارك Ligase أيضًا في تكرار الحمض النووي. في الواقع ، يعكس LIGASE عمل RE ، الذي يكسر روابط العمود الفقري للسكر والفوسفات. يتطلب Ligase طاقة لتشكيل هذه الروابط (الشكل 3). سينضم Ligase إما إلى نهايات "لزجة" أو نهايات "غير حادة" ، ولكنه أكثر كفاءة في إغلاق الأطراف اللزجة لأن "الأجزاء المتدلية اللزجة" من هذه الأطراف تضيف ثباتًا يربط الحوامل معًا أثناء عمل ligase ، في حين أن النهايات غير الحادة تكون أقل مستقر . يجب أن يكون للنهايات اللاصقة نفس "تراكب القاعدة" (الشكل 1) ، ولكن يمكن ربط أي طرف بلونت مع أي طرف غير حاد آخر (الشكل 2).

الشكل 3. رد فعل ليجاس. تصطف الأطراف اللاصقة لخصلي DNA وفقًا لرابط الهيدروجين bp. يشار إلى مواقع القطع بواسطة الأسهم الزرقاء. يرتبط الليجاز بخيوط الحمض النووي المرتبطة بالهيدروجين ويشكل روابط تساهمية بين طرفي الحمض النووي (الروابط الحمراء) ، وبالتالي ينضم إليهما. وبالمثل ، إذا اجتمعت الأطراف غير الحادة للحمض النووي معًا ، يمكن للليغاز أن يشكل روابط تساهمية بينهما.

مراجعة مكونات GE:

(1) يحتوي الحمض النووي مزدوج الشريطة على مواقع إنزيم تقييد متناوب.

(2) العديد من أنواع الإنزيمات المقيدة تقطع أو تشق المواقع المتناظرة في عينة الحمض النووي المزدوج الشريطة التي تشكل إما نهاية لزجة أو غير حادة.

(3) يندمج إنزيم ligase بالإضافة إلى مصدر الطاقة أو ينضم إلى نهايتين لزجتين أو نهايتين غير حادتين من الحمض النووي معًا.

خطوات الهندسة الوراثية

عزل SOURCE و VECTOR DNA. يجب أن تكون الحمض النووي خالية نسبيًا من المواد الملوثة التي تتداخل مع الخطوات الأنزيمية اللاحقة.

يتم قطع كل من الحمض النووي المصدر والمتجه باستخدام إنزيمات التقييد. عندما يتم تشكيل الأطراف اللاصقة ، يتم قطع الحمض النووي بنفس إنزيم (إنزيمات) التقييد ، ولكن RE التي تنتج نهايات غير حادة تعمل أيضًا بشكل جيد في الاستنساخ.

يتم خلط الحمض النووي المتجه والمصدر بنظام LIGASE وتربطهما معًا بشكل تساهمي.

أخيرًا ، يتم تحويل الحمض النووي المرتبط إلى خلية مضيفة. عادة ما تكون الخلية المضيفة عبارة عن بكتيريا كفؤة ، ولكن يتم استخدام الخلايا حقيقية النواة بشكل متزايد. بعد حدوث النمو المناسب ، يتم فحص الخلايا المضيفة بحثًا عن وجود المصدر أو الحمض النووي المستنسخ في السيتوبلازم الخاص به.

غالبًا ما تستغرق عملية الاستنساخ بأكملها أقل من يوم ويتم تنفيذها باستخدام أحجام تصل إلى 1000 ميكرولتر أو أقل. قد يستغرق فحص المضيف المحول للجين المعني يومًا إضافيًا أو نحو ذلك. يقال إن الجين الذي تم نقله بنجاح بهذه الطريقة قد تم استنساخه. يشار إلى هذه العملية باسم "الاستنساخ" أو "تقنية الحمض النووي المتكرر" أو "الحمض النووي المتواصل". يتم تلخيص هذه الخطوات في الشكل 4 أدناه.

الشكل 4. الاستنساخ. للحصول على شكل آخر يوضح الاستنساخ انقر هنا واطلع على الشكل 11 أ.

استخدامات الحمض النووي المستنسخ.

التسلسل: يحدد التسلسل تسلسل زوج القاعدة للجين. من خلال قراءة الكود المكون من 3 أحرف ، يصف التسلسل أيضًا تسلسل حمض أمينو المترجم من هذا الجين.

الطفرة: يمكن تغيير تسلسل الجين bp بطرق معينة ويمكن إدخال الجين المعدل مرة أخرى في مضيفه الأصلي لمعرفة ما تفعله كل طفرة محددة. في حين أن الطفرة التلقائية عشوائية ، فإن التقنيات المتاحة الآن تجعل من الممكن تغيير أي كودون داخل الجين إلى أي كودون آخر. لذلك ، من الممكن دراسة آثار تغييرات الأحماض الأمينية الأحادية على وظيفة منتج الجين ، والذي هو ، بعد كل شيء ، الهدف النهائي للتمرين.

لاستبدال شكل متحور من الجين في الخلية المضيفة الأصلية بشكل صحي من الجين لمعرفة ما يفعله بالضبط في مكان إقامته المقصود.

لاستخدام الجين المضخم لصنع كميات ضخمة من منتج الجينات للأغراض التجارية. هذه هي الطريقة التي يتم بها إنتاج منتجات مثل الأنسولين البشري وهرمون النمو البشري ومنشط البلازمينوجين والإنترلوكين وهرمون حليب الأبقار.

لإدخال الجين في أنواع أخرى لغرض ما. يقال إن هذه الحيوانات أو النباتات عابرة للجنس. على سبيل المثال ، تتم حماية العديد من المحاصيل من يرقات اليرقات بسبب إدخال جين من بكتيريا في خلاياها. ينتج هذا الجين بروتينًا شديد السمية وبشكل خاص يرقات العديد من العث والفراشات التي تهاجم المحاصيل الغذائية.

الكائنات المتحولة

هناك جانب أسفل من شركة جنرال إلكتريك. يمكن أيضًا استخدام نفس الإجراءات التي يمكن استخدامها لإنتاج محصول أفضل ، أو الأنسولين البشري ، لصنع مسببات أكثر قوة. هناك أدلة على أن بعض البلدان لديها أو تفكر في القيام بذلك. على سبيل المثال ، كان العراق على ما يبدو يزرع مسببات الأمراض البكتيرية للحرب البيولوجية ، ولكن تم ردعه عن استخدامها عندما هددنا بالانتقام الذري. إنها مجرد قفزة صغيرة في "التفكير" للنظر في هندسة "مُمْرِض أفضل" يمكن بواسطته تدمير عدو مكروه (املأ الفراغ - التقرير الإخباري الذي يفيد بأن بعض الأمريكيين. يعتبرون أي شخص يعمل لحساب الحكومة هو العدو). لمزيد من المعلومات ، اقرأ "أطياف الأسلحة البيولوجية" Scientific Am. ديسمبر 1996 ، ص. 60.

الشكل 5. استخدام الاستنساخ الجيني لتضخيم الحمض النووي المستنسخ و / أو لإنتاج الكثير من منتج الجين المستنسخ.

سؤال تفكير حاسم: ما الذي يجب أن نفعله حيال تنظيم النباتات والحيوانات المعدلة وراثيًا؟ هل يجب أن نطلب اختبار سلامتها ، وأن يتم تصنيفها على أنها جنرال إلكتريك؟ هل يمكنك التفكير في أي اعتبارات أخرى بخصوص هذه "المنتجات"؟ هل تأكل "الأطعمة المعدلة وراثيا"؟

بصمة الحمض النووي

المبادئ الأساسية الثلاثة المطلوبة لفهم بصمات الحمض النووي وكل ما يليها تعرفه بالفعل (مبدأ الارتباط الترابطي / المستقبلات انظر الشكل 2 الفصل 7) ، لكن الأمر يستحق أخذ لحظة لمراجعتها.

يعتبر الاقتران الأساسي لـ AT (AU) & amp GC هو المبدأ الأساسي لهذا الإجراء. إذا فهمت هذا كل شيء يقع بسهولة في مكانه.

تعد خصوصية نشاط الإنزيم هو المبدأ الأساسي الثاني لفهم بصمة الحمض النووي. يشير هذا إلى قطع الحمض النووي بواسطة إنزيمات التقييد المحددة في متواليات متناظرة فريدة من نوعها.

إن الاعتراف بأن التغيير في زوج قاعدة واحدة (طفرة) يمكن أن يصنع موقع RE حيث لم يكن أحد موجودًا من قبل أو يمكنه إزالة أو إزالة موقع RE من الجين. سيكون القياس هو "تغيير" رقم هاتفك عن طريق المتصلين بحرف واحد من شأنه أن يحصل على شخص مختلف.

لفهم بصمات الحمض النووي ، يجب النظر إلى جزيء الحمض النووي المزدوج الذي تقطعت به السبل كسلسلة ذات مواقع RANDOM RESTRICTION ENZYMES (متجانسة) تقع على طولها. إذا تم تمييز كل موقع من مواقع التقييد الفريدة المختلفة هذه بلون مختلف ، فسيظهر الحمض النووي كشريط عشوائي متعدد الألوان. إذا تم تلوين مجموعة واحدة من مواقع إنزيمات التقييد الفريدة باللون الأحمر وإضافة إنزيم التقييد الأحمر المناسب ، فسيتم تنقية الحمض النووي في سلسلة من الكتل ذات الأحجام المختلفة اعتمادًا على مكان وجود المواقع الحمراء على طول جزيء الحمض النووي (الشكل 6) . من السهل أن نفهم أن مجموعة الكسور ذات الأحجام المختلفة ستكون فريدة من نوعها لجدلي DNA مع مواقع تقييد RED الموجودة في أماكن مختلفة على طول خيوط الحمض النووي المزدوجة الخاصة بها. إن إضافة إنزيم التقييد الأخضر الذي يقطع المواقع الخضراء من شأنه أن ينتج مجموعة مختلفة من الشظايا ذات الحجم. ستمثل كل مجموعة من هذه الشظايا المنتجة بواسطة إنزيم التقييد بصمة فريدة لهذا الحمض النووي (الشكل 6).

الشكل 6. يوجد في هذا الشكل جينان لهما مواقع متناظرة لاثنين من إنزيمات التقييد المختلفة التي تم تمييزها على أنها قضبان خضراء أو حمراء. يتم عرض عدد وحجم أجزاء الحمض النووي التي يمكن أن تنتج إذا تم قطع الحمض النووي الذي يحتوي على هذين الجينين مع إنزيمات التقييد المعنية. حدد النمط الذي ستحصل عليه إذا قمت بقص هذا الحمض النووي باستخدام كل من الإنزيمات في نفس الوقت ، ووضعه من الأصغر إلى الأكبر.

يتم تصوير شظايا الحمض النووي باستخدام التقنية المعروفة باسم الحصر الكهربائي الهلامي ، والتي قمت بها في تمرين معملي 15. باختصار ، يتم استخدام المواد الهلامية المسامية المكونة إما من مادة بلاستيكية تسمى أكريلاميد أو مشتق من أجار ، تسمى أجاروز ، لفصل أجزاء الحمض النووي على أساس بحجم. يتم تحضير المواد الهلامية بآبار تُضاف إليها شظايا الحمض النووي. يتم غمر المواد الهلامية ، تحت محلول عازل للكهرباء بين قطب موجب وسالب ، تضاف المحاليل المحتوية على الحمض النووي إلى الآبار ويتم تشغيل التيار. يتم شحن أجزاء الحمض النووي بشكل سلبي بحيث يتم وضع الآبار التي تحتوي عليها الأقرب إلى القطب السالب. عندما يتم تشغيل التيار ، يتحرك الحمض النووي عبر المسام الموجودة في الهلام باتجاه القطب الموجب. تتحرك الأجزاء الأقصر بشكل أسرع لأنها قادرة على التنقل عبر مسام الهلام بسهولة أكبر ، في حين أن أجزاء الحمض النووي الأطول تتحرك بشكل أبطأ نسبيًا عبر المسام. والنتيجة هي فصل أجزاء الحمض النووي على أساس طولها (الحجم). الحمض النووي ملطخ بالأصباغ التي ترتبط بالحمض النووي وتتألق بقوة عند تعرضها للأشعة فوق البنفسجية. تظهر شظايا الحمض النووي ذات الأحجام المختلفة كسلسلة من العصابات التي تشبه BAR CODE. انظر الشكل 13.

الطفرات وبصمة الحمض النووي أمبير

في الشكل 7 ، تم وصف نمط الهلام للتحليل الافتراضي للحمض النووي لـ O.J. مقابل عينة من الحمض النووي غير المعروف. تم معالجة الحمضين النوويين المعزولين بنفس RE وفصل الشظايا على هلام agarose. يتم رؤية نمطين فريد من نوعه لشظايا إنزيم التقييد. الاستنتاج هو أن عينات الدم جاءت من أفراد مختلفين. يؤثر مصدر الحمض النووي بوضوح على أهمية هذه النتائج. على سبيل المثال ، إذا تم جمع العيّنتين في مسرح الجريمة ، فهذا يعني شيئًا واحدًا ، ولكن إذا جاءت عينة الحمض النووي غير المعروفة من قميص OJ وتطابق ذلك مع أحد الضحايا في مسرح الجريمة ، تكتسب البيانات أهمية أكبر.

الشكل 7. من الواضح أن الحمض النووي من مسرح الجريمة ليس مثل O.J. ، لأن أنماط الشظايا (بصمة الحمض النووي) مختلفة. هل كانوا هم نفس ما سيقال عن براءة أو ذنب O.J.؟

تهجين

الجواب: هذا بالضبط ما يحدث. عندما يتم معالجة الحمض النووي الجينومي باستخدام RE وفصله على مادة هلامية ، فإن ما يُلاحظ هو مسحة مستمرة تتكون من 1،000s من شظايا الحمض النووي الفردية. يتم حل هذه المشكلة بتقنية تعرف باسم التهجين.

يعتمد التهجين مرة أخرى على المبدأ الأساسي لـ HYDROGEN BONDING بين روابط GC & amp AT في الأحماض النووية. المبادئ في خطوات التهجين هي:

يتم فصل خيوط الحمض النووي عن طريق كسر الروابط الهيدروجينية بين القواعد بالحرارة لإنتاج شرائط مفردة.

يعتمد فصل السلك بشكل صارم على عاملين: درجة الحرارة (كمية الطاقة الحرارية) وعدد الروابط الهيدروجينية (الاقتران غير الصحيح للقاعدة لا يشكل روابط H).

عندما تنخفض درجة الحرارة ، فإن خيوط الحمض النووي المفردة في نفس المحلول التكميلي تتكامل بشكل عفوي عن طريق الاقتران من خلال ارتباطات AT & amp GC الخاصة بها. تعتمد قوة الارتباط اللاحق على درجة الحرارة والعدد الإجمالي لأزواج القواعد المطابقة.

عادةً ما يكون اختبار أو عينة الحمض النووي ثابتًا أو مرتبطًا بسطح صلب في حالة فردية. يتم بعد ذلك خلط قطعة من الحمض النووي من التسلسل المعروف والتي يرتبط بها شيء يمكن اكتشافه أو رؤيته مع الحمض النووي المرتبط ويتم تحضين الاثنين معًا في ظل ظروف تسمح لتسلسل الحمض النووي التكميلي بالانضمام من خلال الرابطة الهيدروجينية المناسبة. يسمى جزيء الحمض النووي الذي يمكن اكتشافه بـ PROBE.

الشكل 8. مسبار التهجين. قطعة قصيرة من الحمض النووي من تسلسل معروف (قواعد سوداء) ملحقة بها مادة ريبورتر. عادة ما يكون هذا المراسل عنصرًا مشعًا مثل الفوسفور 32 أو إنزيمًا يحفز إنتاج الضوء من جزيء الركيزة ويشار إليه في هذا الشكل بواسطة المصباح الكهربائي. إذا وجد تسلسل المسبار تسلسلًا أساسيًا مكملًا على الهدف المرتبط أو عينة الحمض النووي ، فسيكون رابطة هيدروجينية به. عندما يتم غسل المجس الزائد غير المنضم بعيدًا عن موقع المسبار المرتبط ويمكن اكتشاف الحمض النووي الخاص به بواسطة ريبورتر الموجود على المسبار.

وهذا يعني أن الروابط الهيدروجينية الأكثر ارتفاعًا يجب أن تكون درجة الحرارة أعلى لفصل خيطي الحمض النووي تمامًا والاحتفاظ بهما منفصلين. على سبيل المثال ، إذا كان هناك حاملان من الحمض النووي يتكونان من 200 زوج قاعدي متكامل تمامًا ، فسيستغرق فصلهما درجة حرارة 58 درجة مئوية. ومع ذلك ، إذا كان 199 زوجًا فقط من أزواج القاعدة صحيحة ، فسيستغرق الأمر 57 درجة مئوية فقط لفصلهم إذا كان هناك 100 زوج قاعدة صحيح فقط ستنهار خيوط الحمض النووي عند

29 درجة مئوية ، أي أن الروابط الأقل تتطلب حرارة أقل (الطاقة = درجات حرارة منخفضة) لتمزيقها.

الشكل 9. في هذا الشكل ، يتم خلط قطعة قصيرة من الحمض النووي ، تسمى PROBE (النجم الوردي) مع شريطين مختلفين من خيوط الحمض النووي الطويلة. يحتوي أحد هذه الخيوط الطويلة على سلسلة من bp تتطابق تمامًا مع تلك الخاصة بالمسبار ، بينما يختلف الآخر بالنسبة إلى bp واحد (بيضاوي أصفر). عند درجة حرارة 55 درجة مئوية ، يرتبط المسبار بكلا من جزيئات الحمض النووي الطويلة ، ولكن عند درجة حرارة 65 درجة مئوية ، لا يرتبط المسبار بجزيء الحمض النووي الطويل مع عدم تطابق زوج أساسي واحد. لا يستطيع المسبار الارتباط بجزيء الحمض النووي الطويل عند 90 درجة مئوية ، فماذا تعتقد أنه قد تكون النتائج عند درجة حرارة 60 درجة مئوية؟

  1. الحمض النووي المعزول مجزأ (CUT) مع إنزيمات تقييدية.
  2. يتم فصل الحمض النووي المقطوع إلى شظايا وفقًا للحجم الموجود على مادة هلامية.
  3. يتم نقل شظايا الحمض النووي ، في موضعها ، إلى غشاء يتم ربطه بإحكام.
  4. يتم نقع الحمض النووي المرتبط بالغشاء في محلول يحتوي على PROBE-DNA المسمى بشيء يمكن اكتشافه (تراه العين).
  5. يتم تحضين خليط مسبار الحمض النووي المرتبط بالغشاء عند درجة حرارة مصممة بحيث تكون خيوط الحمض النووي المسببة التي لديها درجة عالية من التكامل (مطابقة زوج القاعدة) مع خيوط الحمض النووي المرتبطة بالغشاء قادرة على الارتباط (رابطة الهيدروجين ) لبعضهم البعض.
  6. يتم غسل المسبار غير المنضم بعيدًا ويتم تحديد موضع المسبار المرتبط باستخدام نظام الكشف الخاص بالمسبار.

الشكل 10. إجراء التهجين.

الإجراء بأكمله يسمى التهجين. يعمل التهجين بسبب تسلسل المسبار. لن يرتبط مسبار معين إلا بالحمض النووي المرتبط بالغشاء إذا وجد تسلسلًا متطابقًا أو تكميليًا لزوج قاعدة الحمض النووي الذي يشكل روابط كافية للبقاء معًا في ظل ظروف التسخين المستخدمة. وبالتالي إذا لم يتم العثور على متواليات تكميلية مطابقة ، فلن يرتبط أي مسبار (الشكل 10 ، الحمض النووي الأخضر). إذا احتوت واحدة أو اثنتان من 1000 من شظايا الحمض النووي المقيدة على تسلسل مكمل للتسلسل في المسبار ، فإن المسبار سيلزم فقط هذه الأجزاء ، وبالتالي يصبح مرتبطًا بالغشاء من خلال هذا الارتباط مع الحمض النووي المرتبط بالغشاء (الشكل 10 ، الحمض النووي الأحمر). من الممكن اختيار المجسات المعروفة بربطها بتسلسلات معينة أو يمكن عمل مجسات اصطناعية من KNOWN SEQUENCES ، مقابل 1.00 دولار / للقاعدة وإرسالها إليك في غضون 48 ساعة. يمكن طلبها عبر الإنترنت.

شكل 11. الهلام الأصلي ، الموضح في المنتصف ، ينتج مسحة من شظايا الحمض النووي الجيني (انظر الشكل 13). ضمن تلك الألف من الشظايا هي الأجزاء الموضحة على الجل الأيسر مقطوعة من قسم من جزيئي الحمض النووي الأصليين الموضحين في الجزء العلوي الأيسر. عندما يتم تهجين مسحة الشظايا ، المثبتة على غشاء ، بالمسبار (الحمض النووي مع المراسل المرفق [النجمة الخضراء] ، الشكل 8) ، فإن المسبار سوف يتضخم (يرتبط) فقط بتلك الأجزاء التي تحتوي على تسلسل الحمض النووي الذي يكمل التسلسلات الموجودة في المسبار ، أي تلك المناطق الواقعة أسفل DNA المسبار مباشرة. يظهر موقع (الأشكال البيضاوية الوردية) لهذه الأجزاء المكملة المرتبطة بالغشاء على الهلام على اليمين. وبالتالي فإن نظام الكشف "يرى" فقط الأشكال البيضاوية الوردية. انظر الشكل 13 للكشف عن فيلم الأشعة السينية لشظايا الحمض النووي من مسحة الحمض النووي الجينومي.

الشكل 12. مشروع الواجب المنزلي.

في الشكل 12 ، يتم تهجين ثلاثة مجسات مختلفة (A ، B ، & amp C) مقابل شظايا الحمض النووي المرتبطة بالغشاء المفصولة الموضحة على اليمين (من 3 مواد هلامية مكررة). كتمرين ، حدد العصابات التي سيتم تهجينها (ربط) كل من المجسات الثلاثة بهذا ، ارسم ثلاثة مواد هلامية مكررة ، 1 ، 2 ، & amp 3 ودائرة النطاق (النطاقات) في الجل 1 التي سيرتبط بها المسبار A بالهلام 2 & amp 3 يفعلون الشيء نفسه مع المجسين B و amp C على التوالي.

الشكل 13. هذه ثلاث مواد هلامية تجريبية تظهر نتيجة إجراء التهجين. يُظهر الجل A نمط النطاقات الذي يُلاحظ عندما يتم فصل الحمض النووي الجيني ، الذي يتم هضمه بإنزيم تقييد ، على هلام agarose. تمثل المسحات في الممرات من 1 إلى 9 ألف جزء من شظايا الحمض النووي الفردية الناتجة عن هضم إنزيم التقييد. يرجع السبب وراء التداخل المرئي في هذه الممرات إلى التركيز العالي لبعض الجينات. تُظهر المواد الهلامية B & amp C أمثلة على أنماط النطاقات التي تم الحصول عليها عندما يتم تهجين مسحات الحمض النووي الجيني المرتبطة بغشاء باستخدام مجسات محددة. ترتبط المجسات فقط ، أو تهجين ، بعدد قليل من شظايا 1000s التي تحتوي على تسلسلات أساسية تكميلية لتلك الموجودة على المسبار. تعلق على المجسات مادة تنتج LIGHT عند معالجتها بمواد كيميائية معينة ويتم الكشف عن هذا الضوء بفيلم فوتوغرافي ، مما يؤدي في الواقع إلى التقاط صورة لكل موقع من المواقع التي ترتبط فيها المجسات بجزء DNA مكمل على الغشاء. انقر هنا ثم انقر فوق "التهجين" لبعض الرسوم الكاريكاتورية الأخرى للنشاف الجنوبي والرسوم التوضيحية لتقنيات البيولوجيا الجزيئية الأخرى.

يوضح الشكل 14 كيف تم اختبار الدم من تجربة O.J. لتحديد التطابقات. تم استخراج الحمض النووي من عينات الدم المختلفة (من القفازات ، وبرونكو ، والجوارب ، والأجسام وما إلى ذلك) ، وهضمها بواحد أو أكثر من إنزيمات التقييد ، وفصلها على المواد الهلامية ، ونقلها إلى أغشية مرتبطة بالحمض النووي ، وتهجينها بمجسات مختلفة . ثم تمت مقارنة نمط شظايا الحمض النووي (العصابات) من العينات التي "تضيء" من أجل أوجه التشابه والاختلاف.

التعليمات: حول بصمات الحمض النووي.

1 ما مدى جودة (دقة) تحديد الهوية. على سبيل المثال ، هل هي جيدة مثل بصمات الأصابع الكلاسيكية؟

الجواب: من الناحية النظرية ، باستثناء التوائم المتطابقة ، كل شخص على هذا الكوكب لديه بصمة DNA مختلفة. أي أن بصمة الحمض النووي جيدة (مميزة) مثل بصمات الأصابع التقليدية لتحديد الهوية.

2. ما هي مزاياها؟

الإجابة: من الناحية النظرية ، ستعمل بصمة الحمض النووي مع كميات أصغر بكثير من المواد مقارنة ببصمات الأصابع الكلاسيكية ، كما أن الحمض النووي لأمبير يستمر لفترة أطول بكثير من بصمات الأصابع التقليدية. لا تزال العينات المحتوية على الحمض النووي التي مضى عليها عدة سنوات (حتى 25 مليون سنة) صالحة للاستعمال. لا يلزم سوى كميات صغيرة جدًا من الحمض النووي لإجراء اختبار عالي الدقة. على سبيل المثال ، الدم الجاف والسائل المنوي والبصاق والجلد وما إلى ذلك على العينات المخزنة في ملفات متربة لسنوات لا تزال صالحة للاستعمال. يمكن أيضًا استخدام عينات من الحمض النووي المختلط. يعد تنظيف الحمض النووي الذي يحتوي على أدلة أصعب بكثير في تنظيف مسرح الجريمة مقارنة بالأدلة الأخرى ، مثل بصمات الأصابع التقليدية.

3. ما هي حدوده؟

الإجابة: لا توجد حاليًا معايير اتحادية مقبولة للتحكم في جودة اختبار الحمض النووي على الصعيد الوطني. تؤدي الجودة الرديئة والاختبار الذي يتم التحكم فيه بشكل سيئ إلى نتائج مشكوك فيها وغير متوقعة. قد يستخدم المختبر A مجموعة واحدة من الإجراءات والمعايير ، بينما قد يستخدم المختبر B مجموعة أخرى من الإجراءات والمعايير. من الصعب إجراء مقارنات بين النتائج من المختبرين. جودة المختبر الشخصية ليست موحدة. على سبيل المثال ، يجب أن يكون فنيو المختبرات السريرية ، الذين يعملون في المستشفيات والمختبرات السريرية ، معتمدين من قبل دولهم ومن قبل منظمة وطنية تضع معايير عالية من التدريب والخبرة. يتم اختبار المعامل السريرية بشكل متكرر لتحديد ما إذا كانت إجراءاتها تتم بشكل صحيح. يتلقون ويجب أن يحللوا عينات الاختبار التي تعرف وكالات التصديق تكوينها. يتم إرجاع النتائج إلى وكالات التصديق للتقييم. إذا ارتكب المختبر السريري أخطاء كثيرة جدًا ، فسيتم المصادقة على المختبر. لم يكن هذا هو الحال بعد مع مرافق اختبار الحمض النووي.

هل تعتقد أنه يجب أن تكون هناك مجموعة من المعايير الوطنية لاختبار الحمض النووي أم يجب أن تضع كل دولة معاييرها الخاصة؟

حتى إذا كان هناك تطابق تام بين الحمض النووي ، فلا يمكنك أن تقول كيف وصلت العينة المحتوية على الحمض النووي إلى هناك أو متى. في O.J. المحاكمة تم طرح سؤال صالح حول إمكانية غرس الأدلة. ما يجعل هذه الشحنة قوية للغاية هو الحساسية الشديدة للإجراء. وهذا يعني أنه لن يكون من الصعب على شخص ما جمع كمية صغيرة من الدم (قطرة أو قطرتين من أنبوب عينة الدم) ، أو سائل أو أنسجة الجسم من الضحية (مثل الشعر في المشط ، والدم على كلينيكس ، إلخ. .) ووضع هذه المواد حيث من شأنها أن تجرم شخصًا بريئًا.هناك حالات موثقة تم فيها "زرع" كميات من المخدرات والأموال المعلمة وما إلى ذلك ، وأدين الأبرياء بجرائم بسبب هذه الأفعال.

أخيرًا ، يصعب تحليل الدم المختلط بمواد كيميائية خاطئة أو المتحلل بدقة.

4. عند مواجهة أدلة الحمض النووي ، ما هي الأسئلة التي يجب طرحها؟

الإجابة: كما هو موضح أعلاه (وفي تجربة OJ) ، الأسئلة المتعلقة بالتعامل مع الأدلة ، ونوعية الاختبار ، بما في ذلك ضوابط الجودة المستخدمة ، ومهارة موظفي الاختبار ، ودقة تفسير البيانات ، والتلوث المحتمل الأدلة ، وإمكانية الخطأ العرضي ، أو الخطأ المتعمد للأدلة كلها أسئلة صحيحة يجب طرحها بخصوص أدلة الحمض النووي (أو أي دليل على هذه المسألة). نظرًا لتحسن حساسية هذه التقنية القوية واتساع نطاق استخدامها في جميع أنحاء نظام العدالة لدينا ، فمن المهم أن نتعامل مع هذه المشكلات إذا كنا نتوقع العدالة المتساوية للجميع. يجب ألا تغيب عن بالنا حقيقة أنه بغض النظر عن مدى قوة أداة جديدة في مكافحة الجريمة ، فإن فعاليتها النهائية تكون جيدة فقط مثل الأشخاص الذين يستخدمون تلك الأداة.

هل تعتقد أن O.J. إذا كان الأمر كذلك ، فكيف كنت ستصوت بناءً على الدليل فقط لو كنت عضوًا في هيئة المحلفين؟

تفاعل سلسلة البوليمرات

يعد تفاعل البوليميراز المتسلسل أحد هذه الاكتشافات ، مثل بنية الحمض النووي ، عامل التحويل الذي يحدد الطبيعة الكيميائية للحمض النووي ، والإنزيمات التقييدية ، التي أحدثت قفزة نوعية في العلم. تقريبًا في اللحظة التي يتم فيها شرح تفاعل البوليميراز المتسلسل (PCR) لعالم بيولوجي ، تبدأ الأفكار المتعلقة باستخداماته تتدفق من الجميع باستثناء العقول العلمية الأكثر بليدًا. حتى اليوم ، بعد سنوات من اكتشافه ، ما زلنا نطور استخدامات جديدة لـ PCR.

المفارقة في تفاعل البوليميراز المتسلسل هي أن الكائنات الحية تفعل ذلك منذ أن تطورت في الحساء العضوي البدائي لهذا الكوكب منذ 3.5 مليار سنة وكان العلماء على دراية بالتفاصيل العامة لهذه العملية

50 سنة. لوضعها بإيجاز ، فإن PCR تفعل في أنبوب الاختبار ما تفعله كل بكتيريا في أنبوب الوسائط الخاص بها أو على لوحة أجار ، وكل منا يفعله كل يوم ننتج مليارات النسخ الدقيقة من الحمض النووي الخاص بنا ، مما يضخّم ملايين من الحمض النووي الخاص بنا. زمن. تم اكتشاف إنزيم بوليميراز الحمض النووي في الخمسينيات من القرن الماضي وتزداد معرفتنا بهذه العملية منذ ذلك الحين. هذا يعني أن آلاف العلماء قد درسوا تكرار الحمض النووي لمدة 40 عامًا دون أن يتحولوا إلى تفاعل البوليميراز المتسلسل.

يظهر المبدأ الأساسي لـ PCR في الشكل 15. لقد كان معروفًا منذ فترة طويلة أن بوليميريز الحمض النووي يتطلب موقفًا قصيرًا من DNA أو RNA يسمى PRIMER لـ "تمهيد" بدء استنساخ الحمض النووي. كانت عبقرية موليس هي أنه يفسر "أنه إذا أضفت المكونات التالية إلى أنبوب اختبار يحتوي على جزيء DNA واحد ، فيمكنك تكرار وتضخيم جزيء الحمض النووي هذا عدة ملايين مرة في وقت قصير.

عينة من TARGET DNA المراد نسخها. من الناحية النظرية ، هناك حاجة إلى جزيء واحد فقط.

مجموعة من PRIMERS مفردة قصيرة (من 15 إلى 40 قاعدة) من الحمض النووي ، في EXCESS ، سترتبط بمناطق تكميلية من المواقف المتعارضة لجزيء TARGET DNA. يتم تضخيم هذه الاشعال BRACKET منطقة الحمض النووي.

زيادة في 4 نيوكليوتيدات ثلاثي الفوسفات ، ATP ، GTP ، CTP ، TTP.

إنزيم بوليميراز DNA.

العديد من المخازن المؤقتة والعوامل المساعدة مثل أيونات المغنيسيوم التي تتطلبها بوليميراز الحمض النووي.

كانت الحيلة الأخيرة تتمثل في الحصول على حاملي الحمض النووي المستهدفين APART (منفصلان) حتى تتمكن البادئات من الارتباط ويمكن لبوليميراز الحمض النووي أن يقوم بعمله. كان معروفا عنه

50 عامًا من الحرارة تفصل بين مجموعات الحمض النووي وأن الخيوط التكميلية تعود بعد ذلك من خلال الاقتران الأساسي عندما تنخفض درجة الحرارة لاحقًا. لذا قام موليس بتسخين خليطه من الحمض النووي المستهدف والبادئات والنيوكليوتيدات ثلاثية الفوسفات إلى حوالي 90 درجة مئوية لبضع دقائق لفصل الحمض النووي المستهدف. ثم قام بعد ذلك بخفض درجة الحرارة بدرجة كافية للسماح للبادئات ، التي كانت صغيرة وفي فائض كبير ، بربط (ANNEAL) بتسلسلات bp DNA الهدف التكميلية الخاصة بها. عند هذه النقطة أضاف بوليميراز DNA وسمح بحدوث تفاعل البلمرة مع نيوكليوتيدات ثلاثي الفوسفات. أي أن بوليميراز الدنا مملوء بالجزء المفقود من كل خيط مما يجعل منطقتين جديدتين مزدوجتين من الحمض النووي.

الشكل 15. تفاعل البلمرة المتسلسل. للحصول على شكل آخر يوضح PCR ، انقر هنا واعرض رابط "PCR".

تستغرق كل دورة PCR كاملة من 2 إلى 10 دقائق فقط. ومع ذلك ، كانت هناك مشكلة واحدة في النظام الذي ابتكره K.Mullis ، وهي أن بوليميريز الحمض النووي الذي استخدمه قد تم تدميره بواسطة عملية التسخين. كان على موليس إضافة بوليميريز DNA جديد لكل جولة ، والتي كانت تستغرق وقتًا طويلاً ومكلفة. تم حل هذه المشكلة باستخدام بوليميراز الحمض النووي المقاوم للحرارة والذي يحتاج إلى إضافته مرة واحدة فقط. سبق وصف البكتيريا الحرارية التي تعيش في الينابيع الساخنة المغلية. هذه حالة أخرى من العلوم الأساسية المستقبلة والتي تبين أنها مهمة. قد يبدو أن دراسة العوامل المحببة للحرارة مضيعة للمال والوقت لكثير من الناس لأن هذه البكتيريا ، رغم أنها مثيرة للاهتمام بالتأكيد ، لا تسبب المرض للإنسان أو أي شكل آخر من أشكال الحياة. يمكن تقديم الحجة القائلة بأنه من الأفضل للعالم أن يقضي وقته في العمل على السرطان أو بعض الأمراض الرهيبة الأخرى التي تصيب الجنس البشري. ومع ذلك ، فقد اتضح أنه نظرًا لأن بوليميرات الحمض النووي المحبة للحرارة تتحمل درجات حرارة عالية (على سبيل المثال 90 درجة مئوية) لفترات طويلة دون تدميرها ، فهي الحل الأمثل لمشكلة بوليميراز DNA PCR. وهكذا أصبح PCR اليوم أداة ثورية بسبب العلماء الذين درسوا هذه الحرارة الغريبة.

الشكل 16. يمثل هذا الشكل منظورًا آخر لتفاعل تفاعل البوليميراز المتسلسل. وتجدر الإشارة بشكل خاص إلى استخدام تفاعل البوليميراز المتسلسل (PCR) لتضخيم قطاعات الحمض النووي المحددة التي تعتمد على العاملين الأساسيين. عن طريق اختيار البادئات ذات التسلسل الفريد ، أحد الأقواس بطول معروف (جين [جينات)) لجزيء DNA. يُشار إلى المقطع بين قوسين بخطوط متقطعة. تضمن البادئات الحمراء والزرقاء ، من خلال ارتباطها التكميلي بتسلسل bp على خيوط DNA الأبوية ذات الصلة ، أنه سيتم تضخيم جزء الحمض النووي بينهما فقط. يتم عرض خمس دورات من النسخ المتماثل ، باستثناء أن الدورة الأخيرة غير مكتملة. لاحظ أن عدد جزيئات الحمض النووي يزيد بشكل كبير مع كل دورة تكرار.

يتم تشغيل تفاعل PCR القياسي خلال حوالي 30 دورة في بضع ساعات مما ينتج عنه تضخيم الحمض النووي الأصلي بأكثر من 10 9 أضعاف. وبالتالي يمكن تضخيم منطقة DNA معينة لإنتاج كميات كافية للقيام بأي شيء يمكن القيام به باستخدام الحمض النووي المعزول بكميات كبيرة. في حالة وجود دليل على الجريمة ، فهذا يعني أن الحمض النووي في بصيلة شعر واحدة ، أو قطرة واحدة من السائل المنوي أو الدم ، كافية لإثبات وجود شخص ما في مسرح الجريمة. في الواقع ، يمكن تضخيم أي دليل يحتوي على جزء أو أكثر من شظايا الحمض النووي الطويلة بشكل معتدل (على سبيل المثال> 200 زوج قاعدي) باستخدام تفاعل البوليميراز المتسلسل وتحديد RFLP لأغراض تحديد الهوية - أو ربما لبناء ديناصور في نهاية المطاف. ومع ذلك ، في الوقت الحالي ، يبلغ الحد الأقصى للتضخيم حوالي 42 كيلو قاعدة.

ملخص بصمة الحمض النووي

القيود الرئيسية لبصمات الحمض النووي هي الخطأ البشري وجودة التكنولوجيا المستخدمة.

أدى اكتشاف تفاعل البوليميراز المتسلسل إلى زيادة حساسية وتعدد استخدامات بصمات الحمض النووي ، وغير وجه البيولوجيا الجزيئية.

ستسمح هذه التقنيات بتحديد الأمراض المعدية في غضون ساعات أو حتى دقائق. إنهم يسرعون من معدل تسلسل الجينوم البشري ، ويسمحون بالتحقيق في التفاعلات البيئية المعقدة وعلاقات الأنواع التي كانت معقدة للغاية بحيث لا يمكن دراستها.

مرحبًا بكم في عالم الهندسة الوراثية الجديد فقط حافظ على أحزمة المقاعد الخاصة بك ثابتة لأنها ستكون رحلة برية.


ماذا يحدث إذا قمنا بحقن إنزيم تقييد في الدم - علم الأحياء

والأجزاء الأكبر بالقرب من القطب السالب.

---------------

بمجرد أن يتم "تشغيل" الجل ، فإن المهمة الوحيدة المتبقية هي إلقاء الضوء على شظايا الحمض النووي. مع تفاعل البوليميراز المتسلسل ، يكون الجل بالكامل ببساطة

غارقة في محلول تلطيخ. تظهر شظايا الحمض النووي على شكل شرائط صغيرة على الهلام ويمكننا تحديد تقريبي لها

الطول حسب موقعهم على الجل. لإلقاء الضوء على ملف تعريف الحمض النووي من تحليل RFLP ، نحتاج أولاً إلى تعريضه

المجسات ذات العلامات الإشعاعية ، والتي تستهدف على وجه التحديد تسلسلات STR التي نحاول العثور عليها. ثم يمكننا فضح

إلى فيلم أشعة سينية ، والذي سوف يصور فقط الأجزاء التي تم الكشف عنها بواسطة المجسات ذات العلامات الإشعاعية. طالما

نظرًا لاستخدام نفس التقنيات في تحضير جميع العينات في الاختبار ، فإن المقارنة المباشرة لملفات الحمض النووي هي

طريقة دقيقة لمطابقة الهويات أو تأكيد العلاقات. سيكون ملف تعريف الحمض النووي للشخص تقريبًا 50/50

مزيج من والدته وأبيه. يشير تطابق ملف تعريف الحمض النووي الدقيق إلى أن كلتا العينات كانت


شاهد الفيديو: فارماستان - حقنة الرحمة (أغسطس 2022).