معلومة

كيف يمكن قياس حالة الكروماتين؟

كيف يمكن قياس حالة الكروماتين؟



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

لدي بعض بيانات RNA-Seq وأرغب في مواءمتها مع الجينوم المادي ومعرفة أي أقسام الكروماتين مفتوحة هندسيًا ويتم نسخها. تمت محاذاة البيانات بالفعل بالتسلسل ، وكل بحث في Google أقوم به عن الأدوات التي قد تساعد في نهاية المطاف يرسلني إلى حفرة أرنب. ما هي الأدوات الحسابية التي ساعدتك؟


يعد البدء ببيانات الحمض النووي الريبي أمرًا رائعًا ، نظرًا لأن لديك بالفعل كيانات مقسمة بالكامل ، على الرغم من كونها في كيانات مختلفة متحرك النظام الحاكم.

نظرًا لأن مشهد الكروماتين نفسه ديناميكي وقد بدأ استكشاف البيانات عالية الإنتاجية فقط في العقد الماضي ، ففكر في الأدوات والنتائج التالية بعناية ...

قد تجد ما يلي أدوات مفيدة:

  • Archalign ، المنشور (لم يعمل بشكل جيد خلال أيام المحاكمات الخاصة بي)
  • بيانات خريطة حالة الكروماتين Ensembl (انظر تخطيط قاعدة البيانات ، والبناء التنظيمي ، وجينات lincRNA في واجهة الويب لقواعد بيانات Ensembl)

  • HaploReg ، المنشور (الأحدث)


ميزة Multiomics الخاصة: مثيلة الحمض النووي التوافقي ومقايسات الكروماتين تخدم رؤية جديدة

يمكن أن تكون مجموعات المفضلة القديمة ألذ من مجموع أجزائها. من منا لا يترك زبدة الفول السوداني والمربى ، ورقائق البطاطس ، ومثيلات الحمض النووي والكروماتين؟ على الرغم من أنها تبدو فاتحة للشهية ، إلا أنه ليس من السهل جدًا الاجتماع معًا.

تم تطوير العديد من الاختبارات في الماضي للجمع بين تسلسل ChIP و bisulfite ، ومع ذلك ، فقد تطلبت في كثير من الأحيان كميات كبيرة من مدخلات DNA ، وتكاليف تسلسل عالية. هذا جعل التنميط التجميعي لمجموعات صغيرة من الخلايا ، أو خلايا مفردة ، أمرًا مستحيلًا. تم تطوير مجموعة جديدة من التقنيات للتغلب على هذه المشكلات وتقديم توصيف محسن لميزات الكروماتين. في هذه الميزة الخاصة ، نسلط الضوء على أربع طرق اندماجية جديدة ومثيرة لمثيلات الحمض النووي / الكروماتين.

Methyl-ATAC-seq و ATAC-Me: هجوم متعدد الذرات على Epigenome

يجمع كل من Methyl-ATAC seq (mATAC-seq) و ATAC-Me معايسات ATAC-seq و مثيلة الحمض النووي. تم تطوير mATAC-seq في مختبر Paul D. Soloway في جامعة Cornell ، وتم تطوير ATAC-Me في مختبر Emily Hodges بجامعة فاندربيلت. أرادت هذه الفرق الموهوبة تجنب الحاجة إلى استنتاج مواضع تداخل الضربات عند مقارنة بيانات مثيلة الحمض النووي وإمكانية الوصول إلى الكروماتين (ATAC-seq) من مجموعتين منفصلتين من الخلايا. البروتوكول هو مزيج قاتل من ATAC-seq متبوعًا بتسلسل بيسلفيت:

  • يتم إجراء التضمين على النوى باستخدام Tn5 transposase المحمل بأوليغنوكليوتيدات الميثيل ، والذي يحمي المحولات المدمجة من نزع الأمين أثناء معالجة بيسلفيت
  • يتم إصلاح الحمض النووي المرصع في النهاية وتنقيته وتحويله إلى ثنائي كبريتيت وتضخيمه وتسلسله
  • لا تعد قمم ATAC-seq الناتجة مقياسًا لإمكانية الوصول إلى الكروماتين فحسب ، ولكنها تقدم أيضًا في نفس الوقت تحويلات C- & gtT في تسلسلها الذي يعكس مستوى مثيلة الحمض النووي

من خلال الجمع بين هذه الأساليب مع عزل RNA المتزامن ، يمكن أيضًا دمج بيانات التعبير من الخلايا. توفر كلتا الطريقتين حلولًا مبسطة لتمشيط تجارب ATAC-seq و DNA methylation ليس فقط لتوفير الوقت والمال (أقل التسلسل المطلوب) والعينات الثمينة ، ولكن أيضًا توفر قدرًا أكبر من اليقين بأن هذه الميزات تحدث في نفس المواضع الجينومية في نفس عينات.

تعتبر الطرق مفيدة بشكل خاص لتحديد النوافذ الضيقة حيث لا ترتبط مثيلة الحمض النووي وحالة الكروماتين والتعبير ارتباطًا وثيقًا كما يعتقد البعض. تُظهر ورقة ATAC-Me أن مثيلة الحمض النووي ، وإمكانية الوصول إلى الكروماتين ، ومثيلة الحمض النووي يمكن فصلها ، حيث تتغير بشكل مستقل عن بعضها البعض أثناء التطور المبكر ، مع ربط التعبير الجيني بحالة الكروماتين وليس مثيلة الحمض النووي.

EpiMethylTag: اختيار التجار

تم تطوير EpiMethylTag بواسطة مختبر جين سكوك في جامعة نيويورك لمواجهة التحديات المرتبطة بتوصيف مثيلة الحمض النووي في مواقع ربط عامل النسخ (TF). تعتمد العديد من TFs على مثيلة الحمض النووي ، ولكن القيود في الأساليب القديمة تعني أنه تم إجراء القليل من الدراسات على مستوى الجينوم لتقييم ذلك. يجمع EpiMethylTag بين ATAC-seq أو ChIPmentation مع تحويل ثنائي السلفيت (M-ATAC أو M-ChIP ، على التوالي). إليك كيف يتم ذلك:

  • يتم إجراء العلامات باستخدام Tn5 على المحللات النووية (M-ATAC) أو أثناء الترسيب المناعي للكروماتين (M-ChIP)
  • يتم تنقية الحمض النووي ، وتحويل بيسلفيت ، وتضخيم تفاعل البوليميراز المتسلسل ، وتسلسله
  • كما هو الحال في mATAC-seq أعلاه ، فإن مقدار التسلسل الموجود (ATAC-seq أو ChIP-seq ذروة) هو مقياس لانفتاح الكروماتين / ربط TF ، بينما يوفر التسلسل نفسه معلومات مثيلة الحمض النووي

EpiMethylTag هو نهج سريع ومنخفض المدخلات ومفيد لمجموعات الخلايا الأصغر. إنه مثالي لتحديد حالة مثيلة الحمض النووي لمواقع ربط عامل النسخ. نادرًا ما يحدث مثيلة الحمض النووي في مواقع ارتباط TF والكروماتين المفتوح ، ومع ذلك ، وجدت مجموعة الدكتور Skok بعض القمم حيث يحدث هذا. تُظهر هذه المناطق التي يمكن الوصول إليها بشكل كبير والميثيل بشكل كبير نشاط نسخ ، وارتفاع H3K4me1 ، وانخفاض H3K4me3 ، وانخفاض H3K27ac. لا يزال الدور البيولوجي لهؤلاء "المروجين المستقرين" لغزًا مثيرًا.

ScNMT-seq: التفرد في انسايت متعدد الذرات

إن ATAC الكامل على الكروماتين ليس هو النهج الوحيد. يعد scNMT-seq (النواة أحادية الخلية ، والمثيلة ، وتسلسل النسخ) تهديدًا ثلاثيًا تم تطويره بواسطة مختبرات وولف ريك (معهد بابراهام ، المملكة المتحدة) وأوليفر ستيجل (EMBL-EBI ، المملكة المتحدة). يستخدم scNMT-seq GpC methyltransferase لتسمية الكروماتين المفتوح متبوعًا بتسلسل بيسلفيت والحمض النووي الريبي (شكل مُكيف من سلسلة NOME). باستخدام "لا توجد إشارة" كمؤشر للكروماتين المغلق ، فإن الإدخال المنخفض للعينة من الخلايا المفردة لا يمثل مشكلة. وإليك كيف يعمل:

  • يقوم GpC methyltransferase بتسمية الحمض النووي الذي يمكن الوصول إليه في خلايا مفردة مرتبة
  • يتم فصل الحمض النووي الريبي (RNA) والحمض النووي (DNA) ماديًا
  • يخضع الحمض النووي الريبي لإعداد المكتبة والتسلسل باستخدام Smart-seq2
  • يتم التعامل مع الحمض النووي للمكتبة وتسلسل ثنائي سلفيت أحادي الخلية (scBS-seq) ، حيث توفر مثيلة CpG و GpC معلومات حول مثيلة الحمض النووي وشغل النواة ، على التوالي

استخدمت هذه المجموعة scNMT-seq للعثور على تفاعلات جديدة لهذه الطبقات الجزيئية الثلاث في مواقع فردية. أخيرًا ، قاموا أيضًا برحلة أسفل المشهد اللاجيني وفحصوا التمايز بين الخلايا الجذعية السرطانية ، حيث اكتشفوا ديناميكيات متميزة في اقتران الطبقات الجزيئية الثلاث في المناطق ذات الصلة بالتنمية.

بالنسبة لكل هذه التقنيات ، فإن القدرة على العمل من عينة الإدخال في خطوة كبيرة إلى الأمام ، وتجاوز الحاجة إلى افتراض العلامات هي في الواقع متزامنة الحدوث. يمكن لكل من هذه الأساليب الأربعة أن تجعل السعي لفهم كيفية تقديم العلامات اللاجينية معًا أسهل للجميع.


ما هو الترسيب المناعي للكروماتين؟

لا تتفاعل البروتينات مع بعضها فقط ، بل يمكنها أيضًا التفاعل مع الحمض النووي. الترسيب المناعي للكروماتين (ChIP) عبارة عن تقنية تحدد ما إذا كان البروتين المطلوب يتفاعل مع تسلسل DNA معين. غالبًا ما تُستخدم هذه التقنية لدراسة ذخيرة المواقع على الحمض النووي المرتبطة بعوامل نسخ معينة أو ببروتينات هيستون ، ولإلقاء نظرة على المواقع الجينية الدقيقة لتعديلات الهيستون المختلفة (بما في ذلك الأستلة أو الفسفرة أو المثيلة).


خريطة كروماتين أحادية الخلية للأجنة البشرية

يتطلب الانتقال من البويضة المخصبة إلى جنين متعدد القدرات ومستقل نسبيًا تنظيم الكروماتين متعدد الطبقات. توفر دراسة الآن التنميط المتزامن لإمكانية الوصول إلى الكروماتين ومثيل الحمض النووي في الأجنة البشرية قبل الزرع بدقة خلية واحدة.

يمتد تطور ما قبل الانغراس في الأيام الأولى لتكوين الجنين ، من الإخصاب إلى الانغراس في الرحم. في غضون أسبوع ، تغوص الإيبيجينومات المشيجية المتخصصة الموروثة من البويضات والحيوانات المنوية في حالة تعدد القدرات ، ويخضع الجينوم الجنيني لتنشيط الجينوم الزيجوتيكي (ZGA). ومن المثير للاهتمام ، أنه في حين يتم الحفاظ على تقدم ما قبل الانغراس بشكل عام بين الثدييات eutherian ، فإن توقيت ZGA متغير. الاستيقاظ الرئيسي للجينوم الجنيني يحدث في المرحلة المكونة من خليتين في الفئران ، بعد الانقسام الأول ، ولكن يتم تشغيله فقط بعد ثلاثة انقسامات في البشر ، في المرحلة المكونة من 8 خلايا 1. في ظل هذه القيود الزمنية القصيرة ، تتطلب التحولات النسخية المناسبة تنسيقًا وثيقًا بين التغييرات في مثيلة الحمض النووي ، وتعديل هيستون ، وإمكانية الوصول إلى الكروماتين المحلي وتشكل الكروماتين عالي الترتيب. كيف يتم تجميع طبقات التنظيم هذه بالترتيب الزمني والتسلسل الهرمي ، وما هي أهميتها النسبية لتطور ما قبل الانغراس؟ حتى وقت قريب ، تم التعامل مع هذه الأسئلة الأساسية في الغالب من خلال تقنيات منخفضة الدقة ، خاصة في حالة العينات النادرة والثمينة ، مثل الأجنة البشرية المبكرة. لكن تطبيق أساليب التحليل الشامل عالية الدقة ومنخفضة المدخلات يمنح الآن ، من الناحية النظرية ، القدرة على تحليل المبادئ التنظيمية لتطور ما قبل الغرس البشري بطريقة غير منحازة على مستوى الجينوم 2. تم التحقيق في النسخ وميثيلوم الحمض النووي للأجنة البشرية قبل الزرع على مستوى الخلية الواحدة 3،4،5 ، لكن تحليلات إمكانية الوصول إلى الكروماتين لا تزال تتضمن تجمعات من الأجنة 6،7. الأهم من ذلك ، أن العلاقات السببية بين تنظيم النسخ والكروماتين ظلت حتى الآن غير قابلة للوصول في الأجنة البشرية قبل الزرع ، تمت دراسة ميزة تنظيمية واحدة لكل جنين أو لكل مجموعة من الأجنة. علاوة على ذلك ، قد يؤدي الاستخدام المتكرر والضروري للأجنة المختلة الصيغة الصبغية إلى نتائج مربكة بسبب التطور النمائي المتغير.


شكر وتقدير

نشكر W.T. Pu في مستشفى بوسطن للأطفال على التحسين النقدي والبناء للمخطوطة ، وجميع أعضاء مختبر He للمناقشة ومنصة الحوسبة عالية الأداء لمركز علوم الحياة بجامعة بكين. تم دعم A.H. من خلال المنح المقدمة من البرنامج الوطني للبحوث الأساسية في الصين (2017YFA0103402) ، والمؤسسة الوطنية للعلوم الطبيعية في الصين (31571487 و 31771607) ، ومركز بكين-تسينغهوا لعلوم الحياة ، وبرنامج 1000 من المواهب الشبابية في الصين.


شكر وتقدير

يكرس المؤلفون هذه المساهمة للراحل جوناثان ويدوم تقديراً لعمله الرائد في بنية الكروماتين وديناميكياته. يتم دعم العمل في مختبرات المؤلفين من قبل المعاهد الوطنية الأمريكية للصحة (منح GM088409 إلى K.L.) والمجلس الوطني للبحوث الصحية والطبية (منح 471422 و 1009850 و 1009851 إلى D.J.T.). ك. مدعوم من معهد هوارد هيوز الطبي. نشكر U. M. Muthurajan للمساعدة في الشكلين 2 و 5 ، و S. Grigoryev للمناقشة.


أساليب

زراعة الخلايا

تم إجراء جميع التجارب على خلايا 6C2 ، وهي عبارة عن خط خلايا كريات الدم الحمراء للدجاج تم تحويلها بواسطة فيروس داء الأرومة الحمراء للطيور (AEV) [79،80]. تم الحفاظ على الخلايا في وسط أساسي أساسي الحد الأدنى من ألفا (Gibco-BRL ، Gaithersburg ، MD ، الولايات المتحدة الأمريكية) مع 10 ٪ (v / v) مصل بقري جنيني ، 1 ٪ (v / v) مصل دجاج طبيعي ، 100 & # x000b5mol / l & # x003b2-mercaptoethanol (Sigma-Aldrich ، St Louis ، MO ، USA) ، 100 وحدة / مل من البنسلين و 100 & # x003bcg / ml الستربتومايسين (Gibco-BRL) ، بكثافة قصوى تبلغ 1 & # x000d7 10 6 خلايا لكل مل .

جيل من الحيوانات المستنسخة المنقولة بشكل مستقر

تم الحصول على الحيوانات المستنسخة المنقولة بشكل ثابت ، والتي تعبر عن مراسل الفلورسنت ، كما هو موضح سابقًا [81]. باختصار ، تم إصابة خلايا 6C2 بالنووية في جهاز تعداء (Nucleofector & # x02122 II Amaxa Nucleofector & # x02122 Technology) (برنامج T-16) باستخدام مجموعة تجارية (Cell Line Nucleofector & # x000ae Kit V Lonza GmBH ، كولونيا ، ألمانيا) و pT2. CMV-مشيري/ مزيج بلازميد pCAGGS-T2TP (نسبة 5/1). ال pT2.CMV-مشيري تم إنشاء البلازميد باستخدام نفس الإستراتيجية الموضحة لـ pT2.CMV-hKO البلازميد [81] ، إلا أن hKO تم استبدال الجين المراسل بـ مشيري، مستخرج من pRSET-B بلازميد (قدمه الدكتور روجر تسيان ، جامعة كاليفورنيا ، سان دييغو ، كاليفورنيا ، الولايات المتحدة الأمريكية). تشكل تقلبات ولادة / موت mRNA مصدرًا رئيسيًا للعشوائية في التعبير الجيني لأن العديد من أنواع mRNA موجودة بتعداد جزيئي منخفض جدًا داخل الخلايا [58،70،82،83] ، وبالتالي قمنا بتقليل مصدر الضوضاء الداخلية باستخدام الفيروس المضخم للخلايا ( CMV) المروج. سمح لنا الحصول على إشارة قوية أيضًا بالتغلب على التحيز الناجم عن التألق الذاتي في بيانات قياس التدفق الخلوي. الاندماج في الحمض النووي الجيني للمراسل مسموح به من خلال نظام ترانسبوسون Tol2 [84] CMV-مشيري يتم التعرف على التسلسل ، المحاط بزخارف Tol2 ، بواسطة transposase (pCAGGS-T2TP) ، ويتم إدخاله عشوائيًا في الحمض النووي الجيني 6C2. بعد سبعة أيام من ترنسفكأيشن ، تم فرز الخلايا المصابة بالعدوى بشكل ثابت والتي تعبر عن الجين المراسل واستنساخها بشكل فردي في صفيحة دقيقة على شكل حرف U 96 بئر (Cellstar Greiner Bio-One GmBH ، Frickenhausen ، ألمانيا) باستخدام مقياس الخلوي (FACSVantage SE Becton-Dickinson ، Franklin Lakes ، نيوجيرسي ، الولايات المتحدة الأمريكية).

التوصيف الجزيئي والخلوي للنسخ

لكل استنساخ ، تم تحديد مواقع إدخال المراسل الجينومي باستخدام طريقة splinkerette PCR كما هو موضح سابقًا [81] ، من أجل اختيار الحيوانات المستنسخة مع موقع إدخال واحد فقط. باختصار ، تمت تنقية الحمض النووي الجيني المعزول من الحيوانات المستنسخة التي تعبر عن مراسل الجينات عن طريق استخراج الفينول وترسيب الإيثانول ، قبل هضمه لمدة 16 ساعة عند 65 & # x000b0C مع تايأنا ، إنزيم تقييد مع موقع التعرف على 4 نقاط أساس. ثم تم ربط الحمض النووي المهضوم بمحول splinkerette لمدة ساعة واحدة عند 22 & # x000b0C. بعد تنقية المنتج المرتبط ، تم إجراء جولتين من تفاعل البوليميراز المتسلسل (PCR1 و PCR2 المتداخل) باستخدام بادئات مخصصة للتحوير المراسل. مشيري وللمحول الملدن ، والبوليميراز التجاري (AccuPrime & # x02122 Taq DNA Polymerase High Fidelity Invitrogen Inc. ، كارلسباد ، كاليفورنيا ، الولايات المتحدة الأمريكية). ثم تم تنقية منتجات PCR وتسلسلها. أخيرًا ، تم تحديد مواقع إدراج المراسل الجينومي من خلال عمليات البحث عن التشابه باستخدام أداة تحليل التسلسل iMapper [85]. تم تأكيد تحديد مواقع إدخال الحيوانات المستنسخة المحددة باستخدام طريقة splinkerette-PCR عالية الإنتاجية [86] ، مما يسمح بتحليل مئات من الحيوانات المستنسخة. سيتم وصف هذا العمل بالتفصيل في مكان آخر.

لتوصيف الحيوانات المستنسخة وتحليل تأثيرات العلاج (انظر أدناه) ، تم إجراء تحليلات قياس التدفق الخلوي (FACSCanto II Becton-Dickinson) على الخلايا التي تم تكويرها بشكل مؤقت وتعليقها في محلول ملحي فوسفات Dulbecco 1 & # x000d7 (Gibco-BRL). تم تحليل كل عينة باستخدام اكتساب 50000 حدث (بوابات على الخلايا الحية) ، وتم إصلاح عتبة التألق الإيجابية باستخدام خلايا غير منقولة. تم أخذ التباين المحتمل الناتج عن معايرة مقياس التدفق الخلوي في الاعتبار من خلال التحليل المنهجي لجزيئات معايرة التدفق (SPHERO & # x02122 Rainbow Spherotech Inc. ، Lake Forest ، IL ، الولايات المتحدة الأمريكية) ، كمرجع معايرة.

تم استخدام الخلايا غير المصابة بالعدوى المنقولة لقياس التألق الذاتي الأصلي 6C2 ، وتم استخدام الفرق بين مضان الخلايا المصابة بالعدوى المنقولة وغير المنقولة كمؤشر على نشاط الجينات المحورة (لاحظ أن التألق الذاتي تمت إضافته أيضًا بشكل منهجي إلى إخراج النموذج لحساب التوزيع عشرات المسافة).

لكل استنساخ ، تم استخدام مؤشرين بشكل منهجي: MFI (متوسط ​​كثافة التألق) و NV (التباين مقسومًا على المتوسط ​​المربع).

بالنسبة لخلية معينة ، يتم قياس التألق F (من التدفق الخلوي) هو F = Fر+ Fأ وهذا هو مجموع التألق الحقيقي Fر (قادمة من البروتينات المراسل) والتألق الذاتي Fأ(قادم من بقية الخلية). التألق الذاتي ليس ثابتًا ، ولكن له توزيع يتم الحصول عليه باستخدام خلايا غير منقولة. اللحظات الأولى والثانية من F قراءة ببساطة كـ

ومن ثم ، مع كون MFI و NV هو التباين المتوسط ​​والمطبيع للفلورة الحقيقية ، نحصل على:

أخيرًا ، لمقارنة التوزيعات النظرية التي تم الحصول عليها من عمليات المحاكاة (والتي تضمنت فقط مضان المراسل) مع تلك التي تم الحصول عليها من التجارب (والتي تضمنت أيضًا التألق الذاتي) ، تم دمج ناتج النموذج أولاً مع التألق الذاتي التجريبي. تم تنفيذ ذلك عن طريق جمع كل نتيجة محاكاة بقيمة خلية تم اختيارها عشوائيًا من توزيع التألق الذاتي. كان التوزيع الناتج هو الالتفاف بين التوزيع النظري والتوزيع الذاتي ، ثم تمت مقارنته بالتوزيعات التجريبية باستخدام اختبار Kolmogorov-Smirnov.

تحديد مشيري معدلات تحلل الرنا المرسال والبروتين

لتحديد ال مشيري معدل تحلل الرنا المرسال ، تم تقدير تركيز الرنا المرسال باستخدام النسخ العكسي الكمي (qRT) -PCR بعد تحقيق تعطيل النسخ باستخدام علاج الأكتينوميسين د. تمت معالجة نسختين (C5 و C11) ، في نسختين ، لمدة 0 ، 60 ، 124 ، 244 و 488 دقيقة بتركيز نهائي قدره 10 & # x000b5g / ml أكتينوميسين D (A9415 Sigma-Aldrich) ، قبل استخراج الرنا المرسال بعد تعليمات RNeasy & # x000ae Plus Mini Kit (Qiagen Inc. ، فالنسيا ، كاليفورنيا ، الولايات المتحدة الأمريكية). لتحضير اختبار PCR في الوقت الفعلي ، تم نسخ 1 & # x000b5g من إجمالي الحمض النووي الريبي من كل عينة باستخدام SuperScript & # x02122 III First-Strand Synthesis System لـ RT-PCR (Invitrogen Inc.) في وجود سداسي عشوائيين. تم إجراء القياس الكمي لمستويات mRNA بواسطة PCR في الوقت الفعلي في 96 لوحة جيدًا باستخدام نظام PCR في الوقت الفعلي (LightCycler 480 Roche Diagnostics ، بازل ، سويسرا). تم إجراء القياس في حجم نهائي قدره 10 & # x000b5l من خليط التفاعل (يحتوي على 2.5 & # x000b5l من قالب cDNA المخفف 1 في 5) ، تم تحضيره باستخدام مجموعة تجارية (Light Cycler 480 SYBR Green I Kit Roche Diagnostics) وفقًا لـ إرشادات الشركة المصنعة ، ومع ضبط التمهيدي بتركيز نهائي قدره 0.5 & # x000b5mol / l (mCher-For: CCACCTACAAGGCCAAGAA ، mCher-Rev: ACTTGTACAGCTCGTCCATG). تم إنشاء منحنى قياسي داخلي باستخدام التخفيفات التسلسلية (من 2000 إلى 0.02 fg / & # x000b5l) لمنتج PCR المنقى. بدأت ردود الفعل عن طريق تفعيل طق بوليميريز الحمض النووي عند 95 & # x000b0C لمدة 5 دقائق ، تليها 45 دورة تضخيم من ثلاث خطوات تتكون من تمسخ في 95 & # x000b0C لمدة 15 ثانية ، التلدين عند 55 & # x000b0C لمدة 15 ثانية ، والتمديد عند 72 & # x000b0C لمدة 15 ثانية. تم قياس إشارة التألق في نهاية كل خطوة تمديد. بعد التضخيم ، تم تشغيل مرحلة التفكك لتوليد منحنى ذوبان للتحقق من خصوصية منتج التضخيم. تم تحديد نقطة العبور (CP) بواسطة طريقة المشتق القصوى الثانية في برنامج LightCycler & # x000ae 480 (الإصدار 1.5.0). بعد التطبيع ، مع مراعاة الجدوى الخلوية وكمية الرنا المرسال المستخدمة في خطوة النسخ الرجعي ، تم تحديد نصف عمر الرنا المرسال عن طريق ملاءمة تطور كمية الرنا المرسال عن طريق أسلوب أسي منخفض (المربع الأقل).

لتحديد معدل تحلل بروتين mCherry ، استخدمنا قياس التدفق الخلوي لقياس نصف عمر البروتين بعد تعطيل الترجمة باستخدام علاج سيكلوهكسيميد. تمت معالجة الحيوانات المستنسخة C5 و C11 في نسختين لمدة 0 و 16 و 24 ساعة بتركيز نهائي قدره 100 & # x000b5g / & # x000b5l cycloheximide (C4859 Sigma-Aldrich) ، ولكل نقطة زمنية ، كان تألق الخلايا المعالجة يقاس التدفق الخلوي. تمت إزالة مكون التألق الذاتي كما هو موضح سابقًا. تم تحديد عمر النصف للبروتين باستخدام التوافق الأسي لمتوسط ​​التألق منحنى النقصان ، على غرار الإجراء المستخدم لتحديد نصف عمر الرنا المرسال.

العلاجات بعوامل تعديل الكروماتين

لتحليل تأثير حالة الكروماتين على عشوائية التعبير الجيني ، تمت معالجة الحيوانات المستنسخة باستخدام TSA ، وهو مثبط هيستون ديستيلاز (P5026 Sigma-Aldrich) و 5-AzaC ، وهو مثبط لميثيل الحمض النووي (A2385 Sigma-Aldrich). لكل استنساخ ، تم إجراء تجارب المعالجة الحركية المستنسخة مع 500 نانومول / لتر TSA أو 500 & # x000b5mol / l 5-AzaC في خمس نقاط زمنية (0 ، 8 ، 24 ، 32 ، 48 ساعة). لكل نقطة زمنية ، تم علاج 1 & # x000d7 10 6 خلايا (لمدة 0 و 8 و 24 ساعة) أو 5 & # x000d7 10 5 خلايا (لمدة 32 و 48 ساعة) بالعقار ذي الصلة وتتميز بقياس التدفق الخلوي.

نموذج الوصف

يمثل نموذج الحالتين للتعبير الجيني نشاط الكروماتين كعملية "تشغيل-إيقاف" محددة من خلال معدلات الانتقال كتشغيلو كإيقاف(تمثل على التوالي الانتقال "off-on" و "on-off" الانتقال). لتمكين المقارنة مع البيانات التجريبية ، أكمل النموذج نموذجًا بسيطًا من mRNA وديناميكيات البروتين بناءً على نموذجين للإنتاج / التدهور. تم السماح بإنتاج mRNA فقط في حالة "التشغيل" (الكروماتين المفتوح) ولكنه ممنوع تمامًا في حالة "إيقاف التشغيل" (الكروماتين المغلق). وبالتالي يتوافق النموذج مع المعادلات التالية:

أين،كتشغيلهو معدل الانتقال مغلق إلى مفتوح ، كإيقافهو معدل الانتقال المفتوح إلى الإغلاق ، و كتيهي النسبة الناتجة من حالة "التشغيل" ص هو عدد mRNAs ، & # x003c1 هو معدل إنتاج mRNA (عندما يكون الكروماتين مفتوحًا) ، و & # x003c1 & # x002dc هو معدل تدهور mRNA ص هو عدد بروتينات mCherry ، & # x003b3 هو معدل إنتاج mCherry (لكل mRNA) و & # x003b3 & # x002dc هو معدل تدهور mCherry F هي شدة مضان الخلية (بعد طرح الفلورة الذاتية) و & # x003b1، هو معامل التناسب الخطي لتحويل عدد البروتينات إلى مقاييس تألق عشوائية.

يمكن محاكاة هذا النموذج باستخدام SSA (انظر أدناه) للتأكد من سلوك الخلايا المفردة وفي النهاية لحساب توزيعات التألق. يمكن أيضًا اشتقاقه تحليليًا لحساب MFI و NV لمجموعات الخلايا الكبيرة في حالة مستقرة.

الاشتقاق التحليلي للنموذج

اقترح بولسون تعبيرًا تحليليًا للكمية المتوسطة و NV للبروتين في نموذج الحالتين ، كدالة لمعلمات ديناميكيات الكروماتين ومعلمات ترجمة النسخ [45]. في حالة وجود جين واحد مع مراعاة المتغير & # x003b1، تعطي معادلة بولسون:


ملخص

تقوم النيوكليوسومات بتجميع الحمض النووي الجيني في كروماتين. من خلال تنظيم الوصول إلى الحمض النووي للنسخ والتكرار وإصلاح الحمض النووي والتعديل اللاجيني ، يشكل الكروماتين حلقة الوصل لمعظم العمليات النووية. بالإضافة إلى ذلك ، فإن التنظيم الديناميكي للكروماتين يكمن وراء كل من تنظيم التعبير الجيني وتطور الكروموسومات إلى كائنات شقيقة فردية ، والتي يمكن أن تنفصل بشكل نظيف إلى خلايا ابنة مختلفة في الطور. تسلط هذه المراجعة التعاونية الضوء على التقنيات التي ستكون حاسمة في استجواب الأسئلة الرئيسية في الكروماتين وبيولوجيا الكروموسوم بما في ذلك تقنيات الفحص المجهري الحديثة ، وأدوات التلاعب بالكروماتين جسديًا ، وطرق الخلية الواحدة لقياس إمكانية الوصول إلى الكروماتين ، والتصوير الحسابي باستخدام الشبكات العصبية والأدوات التحليلية لتفسير بنية الكروماتين وديناميكياته. بالإضافة إلى ذلك ، تقدم هذه المراجعة وجهات نظر حول كيفية تطبيق هذه الأدوات في مجالات بحثية محددة مثل استقرار الجينوم وعلم الأحياء التطوري واختبار المفاهيم مثل الفصل الطوري للكروماتين.

ساهم هؤلاء المؤلفون بالتساوي


التقدم في أبحاث الكروماتين والكروموسوم: وجهات نظر من مجالات متعددة

تقوم النيوكليوسومات بتجميع الحمض النووي الجيني في كروماتين. من خلال تنظيم الوصول إلى الحمض النووي للنسخ والتكرار وإصلاح الحمض النووي والتعديل اللاجيني ، يشكل الكروماتين حلقة الوصل لمعظم العمليات النووية. بالإضافة إلى ذلك ، فإن التنظيم الديناميكي للكروماتين يكمن وراء كل من تنظيم التعبير الجيني وتطور الكروموسومات إلى كائنات شقيقة فردية ، والتي يمكن أن تنفصل بشكل نظيف إلى خلايا ابنة مختلفة في الطور. تسلط هذه المراجعة التعاونية الضوء على التقنيات التي ستكون حاسمة في استجواب الأسئلة الرئيسية في الكروماتين وبيولوجيا الكروموسوم بما في ذلك تقنيات الفحص المجهري الحديثة ، وأدوات التلاعب بالكروماتين جسديًا ، وطرق الخلية الواحدة لقياس إمكانية الوصول إلى الكروماتين ، والتصوير الحسابي باستخدام الشبكات العصبية والأدوات التحليلية لتفسير بنية الكروماتين وديناميكياته. بالإضافة إلى ذلك ، تقدم هذه المراجعة وجهات نظر حول كيفية تطبيق هذه الأدوات في مجالات بحثية محددة مثل استقرار الجينوم وعلم الأحياء التطوري واختبار المفاهيم مثل الفصل الطوري للكروماتين.


التداعيات والتجارب المستقبلية

الهدف من هذه الأطروحة هو وضع الأساس لنموذج الكروماتين الذي يشتمل على تغييرات هيكلية ثلاثية الأبعاد مع قراءة نصية. مثل هذا النموذج هو أداة تحليلية أساسية ، كما نعتقد ، لحل مشكلة كيفية تحقيق التنظيم على مستوى الجينوم للتعبير الجيني في حقيقيات النوى في الجسم الحي. نقدم نموذجين يستوفيان معايير وجود تغييرات هيكلية في الكروماتين وقراءات النسخ: حالتان وأكبر من نموذج حالتين. لأسباب تتعلق بالاكتمال مع البيانات الموجودة والقدرة على إنشاء فرضيات ، فإننا نفضل نموذجًا به أكثر من حالتين ونقترح أن نموذج الحالة الست هو أفضل تمثيل للمعرفة الحالية من كل من العناصر الوراثية المعزولة والدراسات على مستوى الجينوم. بينما تم اقتراح نماذج أخرى من الكروماتين ، [14،27،44،45] لا يوجد أي شيء على علمنا بهذه المعايير التي تربط البنية بالنسخ كما هو موضح هنا. بالطبع يجب أن يكون نموذج حالات الكروماتين مرتبطًا ارتباطًا وثيقًا بالبيانات & # x02014 نقطة هنا هي أن دمج المعرفة بالوظيفة البيولوجية للكروماتين يمكن أن يؤدي إلى نموذج أكثر قابلية للتتبع. الخطوة التجريبية التالية هي القياس المباشر للسمات الهيكلية التي تحدد الحالات الفردية.

استخدام نموذج حالة الكروماتين

ضمنيًا في نموذج النسخ لحالات الكروماتين هي التغييرات الهيكلية في المستويات المتوسطة من التنظيم ، أي أقل من مستوى الكروموسوم وفوق مستوى النواة الفردية. أحدث العمل الأخير [30،46] مع فرط حساسية الدناز وتحليلات تسلسل MNase والنهج الحسابية ثورة في الطريقة التي نفكر بها في كيفية ارتباط النيوكليوسومات بمناطق مختلفة من الجينوم ومنطق إعادة تموضع مجمعات البروتين هذه بما يتناسب مع ارتباط عامل النسخ. على سبيل المثال ، نحن نعلم الآن أنه في بداية مواقع بدء النسخ ، تُظهر النيوكليوسومات تباعدًا منتظمًا للغاية ، [29] من المحتمل أن تساهم في إحدى حالات & # x0201con & # x0201d في هذا أو نماذج حالة الكروماتين الأخرى. على مستوى عالمي ، يتم إثراء النيوكليوسومات في exons واستنفادها في الإنترونات ، [47] مما يدعم الدور الذي تلعبه كثافة النوكليوسومات في بنية الكروماتين. يتمثل أحد قيود دراسات تسلسل النيوكلياز هذه في أن المعلومات ، على الرغم من الحصول عليها الآن بدقة أساسية واحدة ، يتم عرضها على التمثيل الخطي للجينوم في العملية ، يتم فقد المعلومات ثلاثية الأبعاد. في الواقع ، تمثل هذه المناطق الوسيطة من بنية الكروماتين ، من وجهة نظرنا ، حدودًا رئيسية في دراسة حالات الكروماتين والكروماتين: تقنيات جديدة يمكنها قياس حالات الكروماتين الوسيطة مباشرةً (على سبيل المثال عن طريق التصوير [12 ، 48] و / أو تقنيات التقاط الكروموسومات [ 5،6]) & # x02014 بين مستوى النواة والجينوم بأكمله & # x02014 وربط هذه الحالات بالنسخ ، سيعزز فهمنا لتعبئة الجينوم وبيولوجيا الكروماتين. يمكن أن تتيح هذه الأساليب تمثيلات الكروماتين التي تتضمن كلاً من البنية ثلاثية الأبعاد وشبكات التعبير الجيني ، مثل تلك السمات الخاصة ببنية الكروماتين الخاصة بنوع الخلية (وبالتالي ، توليد النسخ) ، [7] وفي النهاية ، مقارنتها.

تكمن قيمة هذا النموذج في أنه يقدم فرضيات قابلة للاختبار. يتطلب التحويل بين حالات الكروماتين شيئًا آخر غير ركيزة الحمض النووي نفسها ، وهما مرشحان واضحان ومدروسان على نطاق واسع هما الحمض النووي الريبي والبروتين. بصرف النظر عن تفضيلات تسلسل الحمض النووي لأدوات إعادة التشكيل وعوامل النسخ ، فإن كيفية تنسيق التحويل بين الدول على نطاق واسع للجينوم غير معروف. لاختبار ذلك ، قد يحتاج المرء إلى وصف انتقالات تجريبيًا لتحديد اتجاهية الحركة بين الدول. إلى أقصى حد ممكن ، قد يشمل ذلك إعادة تلخيص هياكل الكروماتين واسعة النطاق في المختبر و / أو استخدام النمذجة الرياضية جنبًا إلى جنب مع البيانات التجريبية لتحديد السمات الهيكلية المتميزة ثلاثية الأبعاد ، في حالة وجودها ، والتي تعد سمات مميزة لحالات مختلفة. بمجرد أن يتم إنشاء السمات المميزة الهيكلية ، يمكن قياس أوقات السكون في كل حالة (على غرار ما تم إجراؤه على مستوى الجينوم للنيوكليوسومات الفردية [49]) وهذه المعلومات الكمية المضافة إلى النموذج. يتمثل التحدي الرئيسي في هذا النوع من التجارب في أنه يتم إجراؤه حاليًا على مجموعات (عادةً الملايين) من الخلايا أو على الأنسجة. يمثل عدم التجانس الموجود في مثل هذه المجموعات عقبة فنية كبيرة أمام التحديد الدقيق لأي حدث دون خلوي منفصل ، بما في ذلك إعادة تشكيل الكروماتين ، والطرق الجديدة لقياس التغيرات في مستوى الخلية المفردة [50] ستحدث ثورة في الطريقة التي نفحص بها العمليات دون الخلوية.

الأهم من ذلك ، في حالة اختبار نموذج مثل النموذج المقترح هنا تجريبيًا ، يجب أن تقترن تحليلات إشغال الجينوم (ChIP-seq) بالتعبير (المصفوفات الدقيقة / التسلسل) وتحليل التقاط التشكل الكروموسومي ، لتحديد ما إذا كانت الحالات الهيكلية الدقيقة تصاحب الأنماط المختلفة التي تنبثق من دراسات ChIP-seq والتعبير الجيني. أي من هذه الطرق العالمية الثلاث وحدها غير كافية لتحديد حالات الكروماتين. إذا قبل المرء فرضية حالات الكروماتين المحددة من خلال السمات الهيكلية وحالات النسخ ، فيمكن تفسير أي تحقيق للكروماتين الذي يقيس هذه المخرجات بشكل مباشر أو غير مباشر في سياق هذا النموذج & # x02014 أي ، تعيين مواقع فردية تقاس في نظام معين إلى واحد حالة الكروماتين. في دراسات أكثر شمولاً ، سيسمح هذا بتحديد النسبة المئوية لجينوم الترميز الموجود في أي حالة معينة ، وإذا تم إجراؤه قبل وبعد المحفزات (أو ربما في الخلايا السليمة والمريضة) ، فسوف يلقي الضوء على كيفية إنتاج العمليات الفسيولوجية من التحول أجزاء من الجينوم بين حالات الكروماتين المختلفة. ستسمح مثل هذه الدراسات الشاملة ، التي تزداد شيوعًا ، بدحض النموذج من خلال إظهار وجود حالات كروماتين إضافية استنادًا إلى أجزاء مهمة من الجينوم تُظهر ميزات هيكلية ونسخًا غير محددة في الحالات الحالية ، أو لإثبات عدم وجود ميزات هيكلية التمييز بين حالتين يفترض وجودهما ، مما يعني ضمناً فقط حالات النسخ ، وليس تلك الخاصة بالكروماتين ، وتحديد الاستجابة الفسيولوجية. بغض النظر عن النظام ، تشتمل مدخلات البيانات الرئيسية لمثل هذا النموذج على بيانات النسخ الخاصة بالموقع (المصفوفات الدقيقة و RNA seq & # x02014 كلما زادت الدقة ، كان ذلك أفضل) والقراءات الهيكلية للكروماتين (بشكل أساسي تقنيات مثل MNase-seq ، وتحليل فرط الحساسية DNase و ChIP- seq ، ولكن التصوير الفائق الدقة وتقنيات التقاط الكروموسومات مثل 3C / HiC ستلعب دورًا). نتوقع أن مناطق الجينوم القريبة من بعضها البعض في ثلاثة أبعاد بناءً على بيانات 3C / HiC ستشغل نفس حالة الكروماتين. Insights into cellular phenotype will certainly aid in the use of these models of chromatin states but in principle are not required for their generation. We envision these models being probabilistic to begin with, due to the large amounts of data and distinct number of loci to be considered, although when possible it will be appealing to apply numerical and potentially analytical methods (employing differential equations) to encapsulate the behaviors of chromatin.

Other Contributors to Chromatin States?

While DNA methylation is clearly associated with modulating chromatin function,[51] the discrete structural features it endows make challenging its direct incorporation into a state model. Like histone post-translational modification, context specificity clearly plays a role in determining the readout. Future studies into histone and DNA modifications need to address directly whether there is universal employment of combinations of marks to endow different readouts. Whether there is a code in the strict sense will require omniscient knowledge of all histone modifications (an unrealistic proposition) or a reimagining of what constitutes the digits in such a code. Regardless, if the goal is to understand global remodeling of chromatin, more studies examining histone and DNA modifications need to test readouts of chromatin structure directly, including: DNase sensitivity, MNase digestion, sedimentation analysis in reconstituted chromatin, high resolution microscopy and perhaps most prominently, chromosomal conformation capture techniques. This model posits six states for coding DNA, but only one (“off permanently silenced”) for non-transcribed regions of the genome. A major challenge for structural studies of chromosomes in situ is to determine structures of non-coding regions in a manner that allows them to be linked to phenotype, regardless of whether these non-coding regions directly or indirectly affect transcription.

How does one distinguish whether a structural or transcriptional action is of paramount importance, when evidence for both exists (whereas often when evidence for which comes first, on an atomic scale, does not)? In the case of a transcription factor binding to the promoter of a gene, it is not much of a jump to assume that if the transcription factor induces a structural change important for transcription, then this change should precede transcription. However, for chromatin structural proteins that decorate various coding and non-coding areas of the genome, the simple linear view of local structural changes preceding transcription of the same region quickly becomes inadequate. Thus, when no data on time-course exist (from a straightforward cause-effect point of view), our preference is to consider them as a single event. Novel approaches that can link structural changes to transcriptional outputs when these two events are not connected by the linear DNA strand (i.e. that rely on the endogenous three-dimensional architecture of the genome) will enhance this understanding.

Genomes—the term here referring to the DNA and all the chromatin structural proteins and RNAs that bind it𠅊re self-organizing systems there is no master regulator mechanism that assembles the three dimensional structure of the genome في الجسم الحي. In this property genomes are not unlike proteins themselves,[52] in that structural features arise at secondary, tertiary and quaternary levels to endow functionality not present in the primary protein/DNA sequence. Like protein structures, then, we can examine genome structures in different cells to reveal features endowing cell type specific gene expression profiles. One fundamental difference between these two systems is that proteins are thought to be structurally super-imposable between copies within a cell or between cells we certainly do not imply this to be the case with the genome, where structural similarities between copies of a genome are more likely global patterns (think: cloud formations). From an evolutionary standpoint, structural features that arose in proteins, untraceable to amino acid sequence, are selected for based on function. So too it may be with genomes, in that the structural features of the genome in three dimensions𠅊nd the consequent properties thereby determining how different regions shift their chromatin states— determine phenotype.

يسلط الضوء

Need exists for state models of chromatin to integrate high throughput data

States are defined by both transcriptional و structural features


شاهد الفيديو: الفرق بين الكروماتين والكروماتيد والكروموسوم الصبغي (أغسطس 2022).