معلومة

مستودع الأنماط / الزخارف

مستودع الأنماط / الزخارف


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أنا جديد في هذه المنطقة. أنا باحث أعمل على البحث السريع عن الأنماط في السيناريوهات العامة (على سبيل المثال ، regex في مطابقة السلسلة).

لدي فضول بشأن "التعبير العادي (regex)" (النمط / الفكرة) في المعلوماتية الحيوية. هل يمكن لأي شخص المساعدة في توضيح بعض المستودعات حيث يمكنني رؤية بعض حالات "regex" (يستخدمها الأشخاص في حالات حقيقية)؟

حتى أتمكن من التعرف على مدى تعقيدها وإمكانية تطبيق تقنياتنا.

شكرا لك!


يستخدم Prosite (http://prosite.expasy.org/) التعبيرات العادية للبحث عن مجالات البروتين ، على عكس Pfam. إذا نظرت إلى إدخال ، مثل http://prosite.expasy.org/cgi-bin/prosite/prosite-search-ac؟PDOC00022 ، يمكنك رؤية نموذج الإجماع تحت قسم PATTERN باتجاه القاع. لا تتمتع Prosite بنفس التغطية مثل Pfam ، ولكن سهولة البحث تعني أنه يتم تحديثها بشكل متكرر أكثر ولديها تكامل أقوى مع UniProt.


لا تُستخدم التعبيرات العادية بشكل شائع لتحليل الحمض النووي أو البروتين ، لكن العديد من الأشخاص يستخدمون نماذج ماركوف المخفية (HMMs).

إذا كنت تبحث في مجالات البروتين ، يمكنك العثور على العديد من HMMs هنا: http://pfam.xfam.org/


قد ترغب في قراءة مصفوفات تردد الموقع (PFM) ومصفوفات وزن الموضع (PWMs). تميل هذه إلى أن تكون أكثر حساسية ومفيدة في التعرف على الأنماط في تسلسل الحمض النووي. مثالان لقواعد البيانات مع هذه الأنماط هما TRANSFAC و JASPAR. يمكن أن تكون أنماط Regex مفيدة في تسلسل البروتين في بعض الأحيان ، على الرغم من أن PWM لها تطبيق هناك أيضًا.


يشارك

العمليات التي تولد شبكات العالم الحقيقي التي من المحتمل أن نحللها ، تنتج تواقيع مميزة في طوبولوجيا الشبكات. تُعرف الأنماط الشائعة في الرسوم البيانية باسم Network Motifs ويمكن أن توفر معلومات مهمة حول بنية شبكتنا والعملية التي أنشأتها.

في هذا المنشور ، قدمنا ​​خوارزمية ESU لتعداد جميع الرسوم البيانية الفرعية لشبكة مع عدد محدد من العقد وكيف يمكننا استخدامها لحساب تكرار كل فكرة شبكة.


الملخص

مورد النموذج الخطي حقيقيات النوى (ELM) هو مستودع للزخارف الخطية القصيرة (SLiMs) المنسقة يدويًا والتي تم التحقق من صحتها تجريبياً. منذ الإصدار الأولي منذ ما يقرب من 20 عامًا ، أصبح ELM موردًا لا غنى عنه لمجتمع البيولوجيا الجزيئية لفحص المناطق الوظيفية في العديد من البروتينات. في هذا التحديث ، أضفنا 21 فئة تصميم جديدة ، وأجرينا تنقيحات كبيرة على 12 فئة عزر وأضفنا 400 حالة جديدة تركز في الغالب على تلف الحمض النووي ، والهيكل الخلوي ، والزخارف الفوسفوتيروزينية المرتبطة بـ SH2 ، وتقليد الزخارف بواسطة بروتينات المؤثر البكتيري المسببة للأمراض. يحتوي الإصدار الحالي من قاعدة بيانات ELM على 289 فئة عزر و 3523 حالة بروتينية فردية تم تنسيقها يدويًا من 3467 منشورًا علميًا. ELM متاح على: http://elm.eu.org.


مستودع الأنماط / الزخارف - علم الأحياء

الأشكال الخطية القصيرة (SLiMs) هي أنماط من ثلاثة إلى عشرة AAs متتالية تستخدمها الخلايا حقيقية النواة للمهام التي تشمل: الإشارات ، والتوطين ، والتدهور ، والانقسام التحلل للبروتين.

تستخدم الفيروسات SLiMs لصالحها ، بما في ذلك التداخل مع مسارات المناعة الفطرية المضادة للفيروسات.

يمكن أن تتحمل SLiMs الفيروسية الطفرات ، وتتطور بسرعة لتعديل تفاعلات المضيف ، وتحدث معًا بطريقة معيارية أو تتضمن مجمعات متعددة البروتينات.

تعد SLiMs مفيدة في البيولوجيا التركيبية ، حيث يمكن أن تؤدي التعديلات الطفيفة إلى تغيير خصوصية الهدف ، وتعديل الثبات ، وإعادة برمجة التفاعلات مع مجالات إشارات الخلايا ، وتغيير وظيفة البروتين بطرق أخرى لا تعد ولا تحصى.

بصرف النظر عن الاستخدامات المفيدة المحتملة ، على سبيل المثال ، لإنتاج مناعة أفضل وتطوير تدخلات علاجية ضد الأمراض المعدية ، قد تساعد SLiMs في وصف التهديدات الجديدة والناشئة للصحة العالمية.

تتهرب البروتينات الفيروسية من الوظيفة المناعية للمضيف عن طريق التقليد الجزيئي ، الذي يتم تحقيقه غالبًا بزخارف خطية قصيرة (SLiMs) من ثلاثة إلى عشرة أحماض أمينية متتالية (AAs). تتسامح محاكاة التصميم مع الطفرات ، وتتطور بسرعة لتعديل التفاعلات مع المضيف ، وتتيح التفاعلات المعيارية مع مجمعات البروتين. لا تستطيع الخلايا المضيفة تنسيق التغييرات بسهولة في التعرف على الحافز المحفوظ وواجهات الربط تحت ضغط انتقائي للحفاظ على مسارات الإشارات الحرجة. توفر SLiMs إمكانية استخدامها في البيولوجيا التركيبية ، مثل المستحضرات المناعية والعلاجات الأفضل ، ولكنها قد تشكل أيضًا تحديات للأمن البيولوجي. نقوم بمسح الاستخدامات الفيروسية لـ SLiMs لتقليد بروتينات المضيف ، وموارد المعلومات المتاحة لاكتشاف الحافز. مع استمرار تزايد عدد الأمثلة ، تعد أدوات إدارة المعرفة ضرورية للمساعدة في تنظيم النتائج الجديدة ومقارنتها.


أنماط الجاز & # 038 يلعق

كم عدد مرتجلو موسيقى الجاز الذين يبنون مقطعا منفردًا أصليًا تمامًا؟ قد يكون من العدل أن نقول إن معظم اللاعبين يعتمدون على المقاييس والأنماط (ويعرف أيضًا باسم اللعقات أو العبارات أو في الدوائر الأكاديمية والصيغ). الجاز هي لغة دائمة التطور ، حيث يتم استعارة الأنماط واللعق المعمول بها وتكييفها وتحويلها إلى لغة جديدة. تفرض أنماط جديدة من موسيقى الجاز أحيانًا بنى متناسقة جديدة. غالبًا ما يجمع اللاعبون العظماء بين الاختراع الأصلي التلقائي والأنماط الراسخة لإنشاء المعزوفات المنفردة الجديدة والجديدة ولكن ذات الصلة من الناحية الأسلوبية. قد يكون لدى المبتدئين والكثير من اللاعبين العاديين ومضات من اختراع حقيقي ، لكنهم يحتاجون عادةً إلى التراجع عن استخدام المقاييس والأنماط فقط لمنح الدماغ قسطًا من الراحة.

بالإضافة إلى الأنماط الموجودة على هذه الصفحات ، يمكنك أيضًا العثور على المزيد على صفحات الساكسفون ، بما في ذلك الكثير من IIm7-V7-Is ، وأنماط ولعقات متناقصة وكاملة. يمكن تكييفها بسهولة لأي أداة.

لعق الأسبوع

كل أسبوع ، سأضيف لمسة جديدة هنا ، لذا ضع إشارة مرجعية على الصفحة وتحقق مرة أخرى بانتظام:

إليك عدد قليل لتبدأ به (للتعلم في كل مفتاح بالطبع):

المرفقات وملاحظات الجار

هذا الأول متورط قليلاً ولكنه لعق رائع للغاية. إذا كنت ترغب في تحليله ، فسيبدأ بالتعليق في اليوم الثالث من Am7 ، ثم تُرفق الملاحظتان التاليتان الجذر. قد تتساءل لماذا G # على Am7؟ حسنًا ، إنه يعمل جيدًا في وضع الإغلاق هذا لأنه عبارة عن ملاحظة جارة لونية لـ A ، مثل ملاحظة رئيسية تصل إلى هناك عبر B. يؤدي بشكل جيد إلى F # من D7 (توجيه الصوت). يتضمن المقياس الأخير المتدرج من F # للحل مرة أخرى مع البادئة الصوتية المرتبة التاسعة المسطحة لبعض النكهة ، على الرغم من أنه يمكن بسهولة الحصول على المرتبة التاسعة الطبيعية.

مرة أخرى ، مع هذا قد تتساءل عن الملاحظات خارج الملاحظات ، على سبيل المثال لماذا لدينا حرف E طبيعي في مفتاح C الثانوي. كما هو الحال مع اللعقة السابقة ، فهي ملاحظة مجاورة لـ F لـ D طفيفة 7 مسطحة 5 لذا فهي تعمل بشكل جيد نصف نغمة أقل تؤدي إلى F (مثل النغمة الأولية). C # على Dm7؟ نعم ، إنها & # 8217s ملاحظة مرور لونية بالإضافة إلى ملاحظة الجار. مرة أخرى في العبارة التنازلية ، لدينا b9 ، ثم يتزاوج هذا مع ملاحظة مجاورة أخرى ، F # ، لإحاطة G حيث يتم حلها جميعًا بشكل جيد إلى 5 من C الثانوية ونزولاً إلى الجذر.

هذا المقياس واضح تمامًا ، حيث يتم تشغيل مقياس من F من D طفيفة 7 مسطح 5 ، ويؤدي الصوت إلى الثالث من G7 ثم مرة أخرى عبر F إلى الثالث من C الصغرى. يستخدم الشكل النهائي B كملاحظة مجاورة لجذر C طفيفة

ملاحظة أخرى من الجار كملاحظة رئيسية في جذر D الصغرى 7 b5. & # 8217s شائع جدًا سماع 7 الرئيسية المستخدمة مثل هذا على وتر 7 ثانوي ، طالما أنها تعمل كملاحظة جار أو ملاحظة عابرة.

ستحصل الآن على الصورة: E ملاحظة الجار الطبيعي إلى F. صوت لطيف يقود من C (السابع) إلى B (الثالث من الوتر التالي) ومقياس للأسفل مع b9. في الضربة الثانية للغة C الثانوية ، لدينا حاوية أخرى وملاحظة جار / مقدمة.

الانزلاق الجانبي

هذا لعق خماسي لطيف للغاية وهو أسهل بشكل مخادع مما يبدو أو يبدو. إنها & # 8217s أكثر قليلاً من مجرد لعق حقًا. هذا في D طفيفة ويمكن استخدامه على أخدود طفيف على وتر D واحد. ينزلق إلى G # خماسي ثانوي ، ولكن بعد ذلك يهبط بشكل جيد على G ، حيث يمكنك المتابعة في D الثانوية (تنظر بلا مبالاة كما لو أنك لم تفعل شيئًا ذكيًا للغاية!)


الفرق بين الزخارف والرموز

هناك أوقات لا نفهم فيها ما هو المقصود بكلمة أو فكرة أو فعل أو شيء. نحتاج إلى أشياء أخرى لوصفها من أجل فهم معانيها بشكل صحيح. هذا صحيح بشكل خاص عندما نتعامل مع الأعمال الفنية وفي العالم الأدبي. هذا هو سبب إنشاء الرموز والزخارف: لمساعدتنا على الفهم.

رمز
الرمز هو كائن أو صورة أو كلمة مكتوبة أو صوت يستخدم لتمثيل شيء آخر إما عن طريق التشابه أو الاصطلاح أو الارتباط. كل لغة لها رموز في الواقع ، أسماءنا هي رموز تمثلنا كأفراد. يتم إنشاء الكلمات واللغة بمعنى أوسع من خلال الرموز التي يتواصل بها البشر مع بعضهم البعض. من خلال تجاربنا ومن مصادر مختلفة ، نقوم بإنشاء رموز لشرح وفهم شيء يتعين علينا تفسيره.

نظرًا لأنه يمكن استخدام الرموز لتغيير معنى كلمة أو عبارة ، فيمكنها تغيير الطريقة التي ننظر بها إلى الأشياء. للحصول على معنى الكلمة ، من الضروري استخدام الرموز حتى يمكن فهمها جيدًا. يعتمد معنى الرمز إلى حد كبير على استخدامه وتاريخه والغرض منه.

مثال جيد جدًا للرمز هو الصليب. تستخدم لترمز إلى المسيحية ، الدين الذي يقوم على تعاليم السيد المسيح المصلوب. يستخدم الصليب أيضًا لتذكير المسيحيين بكيفية تألم المسيح من أجل خلاصهم.

عنصر
الفكرة هي صورة أو كلمة منطوقة أو مكتوبة أو صوت أو فعل أو أي جهاز مرئي أو هيكلي آخر له أهمية رمزية. يتم استخدامه لتطوير وإعلام موضوع العمل الأدبي.

يرتبط مفهوم الحافز بموضوع ما ، ولكن على عكس السمة التي هي فكرة أو رسالة ، فإن الحافز هو التفاصيل التي تتكرر في نمط المعنى الذي يمكن أن ينتج سمة أثناء إنشاء جوانب أخرى في نفس الوقت.

يرتبط ارتباطًا وثيقًا بموضوع أو رمز ويستخدم عناصر سردية مختلفة. يتكرر باستمرار لتمثيل فكرة أو موضوع مهيمن أو مركزي في عمل فني. يتعلق الأمر أكثر بالفكر الذي يستخدم لدعم موضوع ما.

ملخص
1. الرمز هو كائن أو صورة أو كلمة مكتوبة أو صوت يستخدم لتمثيل شيء ما. الفكرة هي صورة أو كلمة منطوقة أو مكتوبة أو صوت أو فعل أو أي جهاز مرئي أو هيكلي آخر يستخدم لتطوير موضوع.
2. يمكن تكرار الرمز مرة أو مرتين ، بينما يتكرر الشكل باستمرار.
3. يمكن للرمز أن يساعد في فهم فكرة أو شيء ما ، بينما يمكن أن يساعد الحافز في توضيح ماهية العمل الأدبي أو القطعة الأدبية.
4. يعتمد معنى الرمز على تاريخه والغرض منه بينما يعتمد معنى الحافز على كيفية استخدامه في عمل أدبي معين.


أساليب

قواعد بيانات الشبكة

قواعد البيانات المستندة إلى الأدب للعلاقات المباشرة التي تم التحقق منها تجريبياً لـ الإشريكية القولونية [14] و خميرة الخميرة [15] حيث تم استخدام بكتريا قولونية V1.1 و S. cerevisiae V1.3 متاح في http://www.weizmann.ac.il/mcb/UriAlon. تم استرداد شبكة الثدييات لجينات عامل النسخ (الإنسان ، والفأر ، والجرذان) من قاعدة بيانات TRANSPATH ® Professional (الإصدار 8.3 ، الذي تم إجراؤه في 2007) حول نقل الإشارات [25] وقاعدة بيانات TRANSFAC ® Professional (الإصدار 11.3 ، الذي تم إجراؤه في 2007) في حقيقيات النوى رابطة الدول المستقلة- عمل عناصر تنظيمية للحمض النووي عبر- عوامل الفاعلية [26]. تصف الشبكة العلاقات السببية بين الجينات التي تقوم بترميز عوامل النسخ ، بناءً على تنظيم هذه الجينات من عوامل النسخ. ومع ذلك ، فإن عوامل النسخ نفسها ليست جزءًا من الشبكة ، أي أن سلسلة التفاعل "أكواد الجين أ لعامل النسخ أ التي تنظم الجين ب" تم تلخيصها إلى: "الجين أ ← الجين ب" ، وهي تقنية شائعة الاستخدام عندما استنتاج شبكات تنظيم الجينات. علاوة على ذلك ، يتم تمثيل الجينات على مستوى "التجريد التقويمي" ، حيث تم تلخيص جميع البيانات الخاصة بالأنواع (الإنسان ، والماوس ، والجرذان) التي تشير إلى جينات الثدييات إلى الإدخالات العامة المقابلة.

تم فحص الجينات المختارة (القمم) في شبكات نسخ الخميرة والثدييات للتأكد من صلاحيتها باستخدام مكتبة المعرفة BIOBASE http://www.biobase.de و السكريات قاعدة بيانات الجينوم (ستانفورد Genomic Resources [48]).

تحليل النمط

تم فحص الشبكات بحثًا عن أنماط طوبولوجية ثلاثية الرؤوس باستخدام برنامج FANMOD مع الإعدادات الافتراضية [27 ، 28]. تم تقييم الدلالة الإحصائية لنماذج الشبكة عن طريق Z-Score [15] ، ض = (م حقيقة- م راند)/SD، أين م حقيقةو م راندهي عدد ظهور النموذج في الشبكة الحقيقية والشبكات العشوائية ، على التوالي. SD هو الانحراف المعياري. لا تؤخذ في الاعتبار علامة الحواف (مثل "إيجابية" للتفعيل أو "سلبية" للتثبيط).

تم حساب مؤشر الانفصال الزوجي باستخدام برنامج DiVa [49]. تم إجراء التحليل الإحصائي باستخدام R [50].

مؤشر الانفصال الزوجي للحافة

لتقدير تأثير الحافة الجوهرية الفردية على الاتصالات الزوجية الحالية بين الجينات ، قمنا بتطبيق مؤشر الانفصال الزوجي على حافة كما هو محدد في [24]. وبهذه الطريقة يوضح جزء الأزواج المرتبة من الرؤوس التي تم فصلها عند إزالة الحافة ، أي. مماثل لـ Eq. 1 ، ن هو عدد أزواج الرؤوس المرتبة المرتبطة في شبكة ونحن نفترض ن & GT 0. المصطلح ن' يرمز إلى عدد أزواج الرؤوس المرتبة المتصلة في الشبكة التي نحصل عليها عند حذف الحافة ه. بالتالي، ديس(ه) = 0 الحافة ه ليس حاسمًا لربط زوج الرأس على الأقل. فى المقابل، ديس(ه) = 1 في حالة عدم استمرار اتصال أزواج الرؤوس.


ما هو النمط الذي سينتج عن ختم مطاطي مربع (فكرة) وفكرة تصميم (توقيع)؟ باستخدام الزخارف المعقدة وأفكار التصميم ، ابتكر Escher بعضًا من أكثر الفنون الرياضية روعة على الإطلاق. جرب يدك في إنشاء بعض الأنماط البسيطة هنا.

أولاً ، اختر فكرة لاستخدامها. يُقترح أن تعمل مبدئيًا باستخدام شكل الوجه السعيد لأنه سيوضح بشكل أفضل كيفية تأثير التوقيع على نمط Escher.


العديد من الاختلافات ممكنة بالإضافة إلى تلك المفصلة هنا.



يمكنك أخذ البلاط ، كما فعل Escher بالحبر والنقش الخشبي ، واستخدامه لإنشاء نمط متكرر في الطائرة. يمكنك إنشاء مجموعة متنوعة لطيفة من الأنماط باستخدام القواعد الموضحة أعلاه. كم عدد الأنماط المختلفة التي يمكنك أن تجدها؟ يمكن أن تؤدي التوقيعات المختلفة إلى نفس النمط بشكل أساسي. على سبيل المثال،

تؤدي إلى أنماط متطابقة.

قارن نتائج هذين التوقيعين بإدخال << 1 ، 2> ، <2 ، 1 >> و << 1 ، 4> ، <4 ، 1 >> ، كل على حدة. هذه الأنماط هي إصدارات مستديرة من نفس النمط. قام Escher بحساب عدد الأنماط المختلفة حقًا الموجودة عند استخدام التدوير باعتباره الاختلاف الوحيد. كم عدد الأنماط التي يمكنك أن تجدها؟


بناء على محتوى من المستكشف الرياضي كتبه ستان واجون

التعبيرات العادية

لا تأتي القوة الحقيقية لـ sed من قدرته على استبدال النص ، ولكن من فائدته في استبدال النص بناءً على "الأنماط" أو ، بشكل أكثر رسمية ، التعبيرات العادية. التعبير العادي هو بناء جملة لوصف تطابق النمط في السلاسل. يتم وصف التعبيرات العادية بواسطة الأحرف الفردية التي تشكل النمط المراد البحث عنه ، و "العوامل الوصفية" التي تعدل أجزاء من النمط من أجل المرونة. في [ch] at ، على سبيل المثال ، تعمل الأقواس كمعامل تعريف يعني "أحد هذه الأحرف" ، وهذا النمط يطابق كلاً من cat و hat ، لكن ليس الدردشة. غالبًا ما يتم إنشاء التعبيرات العادية عن طريق ربط التعبيرات الأصغر ، كما في [ch] at على [mh] at ، مطابقة القطة على القبعة ، القطة على الحصيرة ، القبعة على القبعة ، والقبعة على الحصيرة.

في المثال أعلاه ، تم تحديد النمط بأكمله بواسطة _ ، وهو ليس عامل تشغيل من أي نوع ، وبالتالي تم استبدال كل مثيل لـ _ بالمستبدل (حرف مسافة). تعد عوامل التعريف التي تدعمها التعبيرات العادية كثيرة ومتنوعة ، ولكن إليك قائمة أساسية جنبًا إلى جنب مع بعض الأمثلة المستوحاة من الناحية البيولوجية:

  • أحرف أو سلاسل غير وصفية
    • يتم ببساطة مطابقة معظم الشخصيات التي لا تعمل بطريقة وصفية. على سبيل المثال ، _ تطابق _ ، A تطابق A ، و ATG تطابق كودون البداية. (في الواقع ، ATG عبارة عن ثلاثة أنماط فردية محددة في صف واحد.) عندما تكون في حالة شك ، فمن الآمن عادةً الهروب من حرف (عن طريق إضافة شرطة مائلة للخلف) لضمان تفسيرها حرفيًا. على سبيل المثال ، [_ ] يطابق السلسلة الحرفية [_] ، بدلاً من استخدام الأقواس كعوامل وصفية.
    • النقطة تطابق أي حرف واحد. على سبيل المثال ، CC. يطابق أي كودون P (CCA ، CCT ، CCG ، CCC) ، ولكن أيضًا سلاسل مثل CCX و CC٪.
    • يتطابق مع أي حرف واحد محدد في & ltcharset & gt. على سبيل المثال ، تطابق TA [CT] رمز Y (TAC أو TAT).
    • يؤدي وضع ^ كحرف أول داخل أقواس مجموعة الأحرف إلى إبطال المعنى ، مثل أي حرف واحد ليس المسمى بين قوسين متطابقتين. تتطابق TA [^ CT] مع TAT و TAG و TA٪ وما إلى ذلك ، ولكنها لا تطابق TAC أو TAT.
    • يطابق وضع ^ خارج أقواس مجموعة الأحرف بداية سلسلة أو سطر الإدخال. على سبيل المثال ، يؤدي استخدام sed -r 's / ^ ATG / XXX / g' إلى استبدال جميع مثيلات أكواد البداية بـ XXX ، ولكن فقط إذا كانت موجودة في بداية السطر.
    • مشابه لـ ^ ، لكن $ يطابق نهاية السلسلة أو السطر. لذا ، فإن sed -r 's / ATG $ / XXX / g' يحل محل جميع أكواد البداية الموجودة في نهاية السطور الخاصة بها.

    حتى الآن ، لم تكن أنماطنا بهذه المرونة حقًا ، لأن معظم القطع التي تمت تغطيتها حتى هذه النقطة تتطابق مع حرف واحد. العاملات الفوقية الخمس التالية تحل هذا القيد.

      • يعدل النمط السابق بحيث يتطابق إذا حدث بين x و y مرات متتالية ، ضمناً. على سبيل المثال ، تتطابق [GC] <4،8> مع أي سلسلة من أحرف C و / أو G تتكون من أربعة إلى ثمانية أحرف (تصوير لثمانية أحرف ، إن أمكن). لذا ، فإن sed -r 's / [GC] <4،8> / _ X_ / g' سينتج عنه الاستبدالات التالية:
        • ATCCGTCT إلى ATCCGTCT (لا بديل)
          ATCCGCGGCTC إلى AT_X_TC
          ATCGCGCGGCCCGTTCGGGCCT إلى AT_X_CCGTT_X_T
        • تعد علامة الجمع (+) هي أبرز معدّل التكرار ، وهي تعدل النمط السابق بحيث تتم مطابقتها مرة واحدة أو أكثر وهي تكافئ <1،>. على عكس المثال أعلاه ، فإن ATG [ATGC] + TGA يطابق ATGTACCTTGA و ATGCTGA ، ولكن ليس ATGTGA.
        • يمكن استخدام الأقواس لتجميع تعبير أو سلسلة من التعبيرات في وحدة واحدة بحيث يمكن تشغيلها معًا. لأن AT هو النمط A متبوعًا بـ T ، على سبيل المثال ، AT + تطابق AT و ATT و ATTT وما إلى ذلك. إذا أردنا بدلاً من ذلك مطابقة تكرارات AT ، فقد نرغب في تحديد نمط مثل (AT) + ، والذي يطابق AT و ATAT و ATATAT وما إلى ذلك. تقوم الأقواس أيضًا "بحفظ" السلسلة التي تمت مطابقتها بداخلها لاستخدامها لاحقًا. يُعرف هذا بالإحالة الخلفية ، تمت مناقشته أدناه.
        • تطابق إما النمط & ltpattern x & gt أو النمط & ltpattern y & gt. يمكن ربط العديد من هذه الأنماط أو العمليات ، على سبيل المثال ، TAA | TAG | TGA يطابق أيًا من أكواد الإيقاف الأساسية الثلاثة. هذا المثال غامض بعض الشيء ، على الرغم من ذلك: هل يقرأ هذا النمط "TA (A أو T) A (G أو T) GA" أو "TAA أو TAG أو TGA"؟ لجعله ملموسًا ، ربما نرغب في تحديده كـ ((TAA) | (TAG) | (TGA)).

        باستخدام هذه القطع ، يمكننا تجميع تعبير عادي يعمل بمثابة مكتشف إطار قراءة بسيطًا (وليس مفيدًا في الواقع). بالنسبة للتسلسلات بدائية النواة (حيث لا يتم أخذ الإنترونات بعين الاعتبار) ، سنقوم بتعريفها على أنها رمز البداية ATG ، متبوعًا برمز واحد أو أكثر ، متبوعًا بواحد من أكواد الإيقاف الأساسية الثلاثة TAA أو TAG أو TGA. نمط البداية هو ATG ، وقد رأينا كيف يمكننا ترميز نقطة توقف أعلاه ، باستخدام ((TAA) | (TAG) | (TGA)). ماذا عن "كودون واحد أو أكثر؟" حسنًا ، يتم تجسيد "واحد أو أكثر" في عامل التشغيل + ، والرمز هو أي ثلاث علامات A أو T أو C أو G. لذلك ، يتم ترميز "واحد أو أكثر من الكودونات" كـ ([ACTG] <3،3>) +. وبالتالي ، فإن التعبير المعتاد لبرنامج البحث عن إطار القراءة المفتوح البسيط هو:

        في الواقع ، لا تُستخدم التعبيرات النمطية غالبًا في البحث عن مناطق الترميز (على الرغم من أنها تُستخدم أحيانًا لتحديد الأشكال الأصغر). جزء من السبب هو أن التعبيرات النمطية ، بشكل افتراضي ، جشع: يتطابقون مع النمط الذي يحدث لأول مرة ، ويسعون لمطابقة أكبر قدر ممكن من السلسلة. (الآلية الخلوية التي تعالج إطارات القراءة المفتوحة ليست جشعة بهذه الطريقة.) ضع في اعتبارك التسلسل التالي ، الذي يحتوي على ثلاثة إطارات قراءة مفتوحة وفقًا لتعريفنا البسيط والتعبير العادي أعلاه.

        لاحظ أن السلسلة TAG هي نوع من الكودون بشكل عام ([ACTG] <3،3>) وإيقاف ، لذلك من الناحية الفنية كلا الخيارين الأولين صالحان وفقًا للتعبير العادي. وفقًا لقواعد الجشع ، سيتم مطابقة الأول ، والذي يمكننا التحقق منه بصدى بسيط وسهل.

        يشبه تركيب التعبير النمطي المستخدم بواسطة sed الصيغة المستخدمة في لغات مثل بيرل وبايثون ور. وظائفهم الخاصة بدلاً من استدعاء sed). إحدى الميزات المفيدة التي توفرها محركات التعبير النمطي الأكثر حداثة مثل هذه هي أنه يمكن جعل المشغلين مثل * و + غير متفقين (على الرغم من أنني أفضل المصطلح الأكثر وضوحًا "متردد") من خلال اتباعهم بعلامة استفهام. في Python ، فإن التعبير العادي ATG ([ACTG] <3،3>) +؟ ((TAA) | (TAG) | (TGA)) سيطابق الخيار الثاني. (عندما لا تتبع علامة * ، أو + ، فإنها تجعل الخيار السابق اختياريًا ، وبالتالي فإن TG (T)؟ CC تعادل TG (T) <0،1> CC.) المزيد من الميزات المتطورة تسمح للمستخدم بالوصول إلى جميع التطابقات في نمط ، حتى لو كانت متداخلة ، بحيث يمكن سحب أكثرها إرضاءً من خلال بعض المعايير الثانوية. لسوء الحظ ، لا تدعم sed المطابقة غير المتشددة والعديد من ميزات التعبير العادي المتقدمة الأخرى.


        رومانسكو بروكلي

        WIRED هو المكان الذي يتحقق فيه الغد. إنه المصدر الأساسي للمعلومات والأفكار التي تجعل العالم في حالة تحول مستمر. توضح محادثة WIRED كيف تغير التكنولوجيا كل جانب من جوانب حياتنا - من الثقافة إلى الأعمال ومن العلم إلى التصميم. الاختراقات والابتكارات التي نكشف عنها تؤدي إلى طرق جديدة في التفكير ، واتصالات جديدة ، وصناعات جديدة.

        © 2021 كوندي ناست. كل الحقوق محفوظة. يشكل استخدام هذا الموقع قبولًا لاتفاقية المستخدم وسياسة الخصوصية وبيان ملفات تعريف الارتباط وحقوق الخصوصية الخاصة بك في كاليفورنيا. سلكي قد تكسب جزءًا من المبيعات من المنتجات التي يتم شراؤها من خلال موقعنا كجزء من شراكاتنا مع تجار التجزئة. لا يجوز إعادة إنتاج المواد الموجودة على هذا الموقع أو توزيعها أو نقلها أو تخزينها مؤقتًا أو استخدامها بطريقة أخرى ، إلا بإذن كتابي مسبق من Condé Nast. خيارات الإعلان


        شاهد الفيديو: Shawl crochet floral motifs. The connection of fragments related to Tenerife. Master class. (يونيو 2022).


تعليقات:

  1. Dagor

    هم ضليعين في هذا. يمكنهم المساعدة في حل المشكلة. معا يمكننا إيجاد حل.

  2. Kenan

    إنها الفضيحة!

  3. Willa

    موافق ، عبارة مفيدة للغاية



اكتب رسالة