معلومة

16.12: الاستنساخ - علم الأحياء

16.12: الاستنساخ - علم الأحياء


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

الاستنساخ الجزيئي

بشكل عام ، تعني كلمة "استنساخ" إنشاء نسخة متماثلة كاملة ؛ ومع ذلك ، في علم الأحياء ، يشار إلى إعادة تكوين كائن كامل باسم "الاستنساخ التناسلي". قبل وقت طويل من محاولات استنساخ كائن حي بأكمله ، تعلم الباحثون كيفية إعادة إنتاج المناطق المرغوبة أو أجزاء من الجينوم ، وهي عملية يشار إليها باسم الاستنساخ الجزيئي.

يسمح استنساخ أجزاء صغيرة من الجينوم بمعالجة ودراسة جينات معينة (ومنتجاتها البروتينية) ، أو مناطق غير مشفرة في عزلة. البلازميد (يسمى أيضًا ناقل) هو جزيء DNA دائري صغير يتكاثر بشكل مستقل عن الحمض النووي الصبغي للكائنات الحية الدقيقة مثل بكتريا قولونية. في الاستنساخ ، يمكن استخدام جزيئات البلازميد لتوفير "مجلد" لإدخال جزء DNA المطلوب. عادة ما يتم إدخال البلازميدات في مضيف بكتيري للتكاثر. في السياق البكتيري ، يُشار إلى جزء الحمض النووي من الجينوم البشري (أو جينوم كائن حي آخر قيد الدراسة) باسم الحمض النووي الأجنبي، أو الجينات المعدلة وراثيا ، لتمييزها عن الحمض النووي للبكتيريا ، والتي تسمى مضيف DNA.

تحدث البلازميدات بشكل طبيعي في التجمعات البكتيرية (مثل الإشريكية القولونية) ولها جينات يمكن أن تسهم في سمات مواتية للكائن الحي ، مثل مقاومة المضادات الحيوية (القدرة على عدم التأثر بالمضادات الحيوية). تمت إعادة توجيه وهندسة البلازميدات كنواقل للاستنساخ الجزيئي والإنتاج الواسع النطاق للكواشف المهمة ، مثل الأنسولين وهرمون النمو البشري. من السمات المهمة لناقلات البلازميد السهولة التي يمكن بها إدخال جزء دنا أجنبي عبر موقع استنساخ متعدد (MCS). MCS عبارة عن تسلسل DNA قصير يحتوي على مواقع متعددة يمكن قطعها باستخدام نوكليازات داخلية تقييدية مختلفة متاحة بشكل شائع. نوكليازات تقييدية التعرف على تسلسلات الحمض النووي المحددة وقطعها بطريقة يمكن التنبؤ بها ؛ يتم إنتاجها بشكل طبيعي بواسطة البكتيريا كآلية دفاع ضد الحمض النووي الغريب. تقوم العديد من نوكليازات التقييد بعمل جروح متداخلة في خيطي الحمض النووي ، بحيث يكون للنهايات المقطوعة 2 أو 4 قاعدة مفردة متدلية. نظرًا لأن هذه الأجزاء المتدلية قادرة على التلدين باستخدام الأجزاء المتدلية التكميلية ، فإنها تسمى "النهايات اللاصقة". إضافة إنزيم يسمى DNA ligase ينضم بشكل دائم إلى شظايا الحمض النووي عبر روابط phosphodiester. بهذه الطريقة ، يمكن تقسيم أي جزء من الحمض النووي الناتج عن انشقاق نوكلياز تقييد بين طرفي DNA البلازميد الذي تم قطعه بنفس نوكلياز التقييد (الشكل 1).

جزيئات الحمض النووي المؤتلف

تسمى البلازميدات التي تحتوي على DNA غريب يتم إدخالها فيها الحمض النووي معاد التركيب الجزيئات لأنها خلقت بشكل مصطنع ولا تحدث في الطبيعة. وتسمى أيضًا جزيئات خيمرية لأنه يمكن إرجاع أصل أجزاء مختلفة من الجزيئات إلى أنواع مختلفة من الكائنات الحية أو حتى إلى التوليف الكيميائي. تسمى البروتينات التي يتم التعبير عنها من جزيئات الحمض النووي المؤتلف البروتينات المؤتلفة. ليست كل البلازميدات المؤتلفة قادرة على التعبير عن الجينات. قد يلزم نقل الحمض النووي المؤتلف إلى ناقل (أو مضيف) مختلف مصمم بشكل أفضل للتعبير الجيني. يمكن أيضًا تصميم البلازميدات للتعبير عن البروتينات فقط عندما يتم تحفيزها بواسطة عوامل بيئية معينة ، بحيث يمكن للعلماء التحكم في التعبير عن البروتينات المؤتلفة.

شاهد رسمًا متحركًا لإعادة التركيب في الاستنساخ من مركز تعليم الحمض النووي.

الاستنساخ الخلوي

الكائنات أحادية الخلية ، مثل البكتيريا والخميرة ، تنتج بشكل طبيعي مستنسخات من نفسها عندما تتكاثر لاجنسيًا عن طريق الانشطار الثنائي ؛ هذا هو المعروف باسم الاستنساخ الخلوي. يتكاثر الحمض النووي من خلال عملية الانقسام ، مما يخلق نسخة طبق الأصل من المادة الجينية.

سؤال الممارسة

أنت تعمل في مختبر البيولوجيا الجزيئية ، وبدون علمك ، ترك شريكك في المختبر الحمض النووي الجيني الغريب الذي تخطط لاستنساخه على طاولة المختبر طوال الليل بدلاً من تخزينه في الفريزر. نتيجة لذلك ، تم تحللها بواسطة نوكليازات ، لكنها لا تزال تستخدم في التجربة. من ناحية أخرى ، فإن البلازميد جيد. ما هي النتائج التي تتوقعها من تجربة الاستنساخ الجزيئي؟

  1. لن تكون هناك مستعمرات على الصفيحة البكتيرية.
  2. ستكون هناك مستعمرات زرقاء فقط.
  3. ستكون هناك مستعمرات زرقاء وبيضاء.
  4. ستكون المستعمرات البيضاء فقط.

[كشف الإجابة q = ”511969 ″]اظهر الاجابة[/ تكشف الجواب]
[إجابة مخفية أ = ”511969 ″] الإجابة ب. ستؤدي التجربة إلى مستعمرات زرقاء فقط. [/ hidden-answer]

الاستنساخ التناسلي

الاستنساخ التناسلي هي طريقة تستخدم لعمل استنساخ أو نسخة متطابقة من كائن متعدد الخلايا بأكمله. تخضع معظم الكائنات متعددة الخلايا للتكاثر بالوسائل الجنسية ، والتي تتضمن التهجين الجيني لشخصين (الوالدين) ، مما يجعل من المستحيل توليد نسخة متطابقة أو استنساخ لأي من الوالدين. جعلت التطورات الحديثة في التكنولوجيا الحيوية من الممكن تحفيز التكاثر اللاجنسي للثدييات في المختبر.

يحدث التوالد العذري ، أو "الولادة العذراء" ، عندما ينمو الجنين ويتطور دون حدوث إخصاب البويضة ؛ هذا شكل من أشكال التكاثر اللاجنسي. مثال على التوالد العذري يحدث في الأنواع التي تضع فيها الأنثى بيضة وإذا تم إخصاب البويضة ، فإنها تكون بيضة ثنائية الصبغيات ويتطور الفرد إلى أنثى ؛ إذا لم يتم تخصيب البويضة ، فإنها تظل بويضة أحادية العدد وتتطور إلى ذكر. تسمى البويضة غير المخصبة بالبيضة العذرية أو البكر. تضع بعض الحشرات والزواحف بيضًا مكرّرًا للتكاثر يمكن أن يتطور إلى بالغ.

يتطلب التكاثر الجنسي خليتين ؛ عندما تندمج البويضة أحادية الصيغة الصبغية وخلايا الحيوانات المنوية ، ينتج عن ذلك زيجوت ثنائي الصيغة الصبغية. تحتوي نواة اللاقحة على المعلومات الجينية لإنتاج فرد جديد. ومع ذلك ، فإن التطور الجنيني المبكر يتطلب المادة السيتوبلازمية الموجودة في خلية البويضة. هذه الفكرة تشكل أساس الاستنساخ التناسلي. لذلك ، إذا تم استبدال النواة أحادية الصيغة الصبغية لخلية بويضة بنواة ثنائية الصبغيات من خلية أي فرد من نفس النوع (تسمى المتبرع) ، فإنها ستصبح زيجوتًا مطابقًا وراثيًا للمتبرع. نقل نواة الخلية الجسدية هو تقنية نقل نواة ثنائية الصبغيات إلى بويضة منزوعة النواة. يمكن استخدامه للاستنساخ العلاجي أو الاستنساخ التناسلي.

كان أول حيوان مستنسخ هو دوللي ، وهي شاة ولدت في عام 1996. وكان معدل نجاح الاستنساخ لأغراض التكاثر في ذلك الوقت منخفضًا للغاية. عاشت دوللي لمدة سبع سنوات وتوفيت بسبب مضاعفات في الجهاز التنفسي (الشكل 2). هناك تكهنات بأنه نظرًا لأن الحمض النووي للخلية ينتمي إلى فرد أكبر سنًا ، فقد يؤثر عمر الحمض النووي على متوسط ​​العمر المتوقع للفرد المستنسخ. منذ دوللي ، تم استنساخ العديد من الحيوانات مثل الخيول والثيران والماعز بنجاح ، على الرغم من أن هؤلاء الأفراد غالبًا ما يظهرون تشوهات في الوجه والأطراف والقلب. كانت هناك محاولات لإنتاج أجنة بشرية مستنسخة كمصادر للخلايا الجذعية الجنينية ، يشار إليها أحيانًا بالاستنساخ لأغراض علاجية. ينتج الاستنساخ العلاجي خلايا جذعية لمحاولة معالجة الأمراض أو العيوب الضارة (على عكس الاستنساخ لأغراض التكاثر ، الذي يهدف إلى تكاثر كائن حي). ومع ذلك ، واجهت جهود الاستنساخ العلاجي مقاومة بسبب اعتبارات أخلاقية حيوية.

سؤال الممارسة

هل تعتقد أن دوللي كانت من الأغنام الفنلندية دورست أو الأغنام الاسكتلندية ذات الوجه الأسود؟

[صفوف منطقة الممارسة = "2 ″] [/ منطقة الممارسة]
[تكشف-الإجابة q = ”985505 ″]اظهر الاجابة[/ تكشف الجواب]
[hidden-answer a = ”985505 ″] كانت Dolly من الأغنام الفنلندية Dorset لأنه على الرغم من أن الخلية الأصلية جاءت من خروف اسكتلندي ذو وجه أسود وكانت الأم البديلة ذات وجه أسود اسكتلندي ، فإن الحمض النووي جاء من Finn-Dorset. [/ مخفي -إجابه]


نظام خالٍ من الخلايا مستوحى من الحيوية لإنتاج القنب من مدخلات غير مكلفة

يمكن أن يوفر نقل إنتاج القنب بعيدًا عن تقلبات استخراج النباتات إلى الميكروبات المهندسة مصدرًا متسقًا وأنقى وأرخص وأقل ضررًا بيئيًا لهذه الجزيئات العلاجية المهمة ، لكن الإنتاج الميكروبي يواجه تحديات ملحوظة. يتمثل أحد البدائل للميكروبات والنباتات في إزالة تعقيد الأنظمة الخلوية عن طريق استخدام التخليق الحيوي الأنزيمي. نحن هنا نصمم وننفذ نظامًا جديدًا خالٍ من الخلايا لإنتاج القنب بالميزات التالية: (1) هناك حاجة إلى مدخلات منخفضة التكلفة فقط (2) يتم استخدام 12 إنزيمًا فقط (3) لا يتطلب النظام أكسجين و (4) نحن نستخدم نظام إنزيم غير طبيعي لتقليل متطلبات ATP التي تنطبق بشكل عام على المسارات المعتمدة على malonyl-CoA مثل التخليق الحيوي للبوليكيتيد. ينتج النظام

0.5 غرام لتر -1 حمض الكانابيجيروليك (CBGA) أو حمض الكانابيجروفارينيك (CBGVA) من مدخلات منخفضة التكلفة ، أي ما يقرب من أمرين من حيث الحجم أعلى من الإنتاج المعتمد على الخميرة. قد توفر الأنظمة الخالية من الخلايا مثل هذا طريقًا جديدًا لإنتاج القنب الموثوق به.


المواد والأساليب

تضخيم PCR للعزل الأولي للحمض النووي الجيني لمستقبلات جديدة. يشفر التمهيدي الأمامي (OPS3: CATAGCCCTCGACCGGTACT) النهاية السيتوبلازمية لمجال الغشاء الثالث منذبابة الفاكهة مستقبلات الأوكتوبامين / التيرامين (OctyR99AB) (أراكاوا وآخرون ، 1990). يقوم التمهيدي العكسي (OPS4: GGCAGCCAGCAGATGACGAA) بترميز المنطقة الوسطى من مجال الغشاء VI من هذا المستقبل. كان قالب PCR 300 نانوغرام من ذبابة الفاكهة الحمض النووي الجيني المحضر من ذباب كانتون-إس البالغة من النوع البري (جويت ، 1986). احتوى خليط PCR 100 ميكرولتر على 0.2 متر لكل من ثلاثي فوسفات deoxyribonucleotide ، 10 متر m محلول Tris-HCl ، درجة الحموضة 8.3 ، 50 متر كلوريد الصوديوم ، 1.5 متر MgCl2، 0.001٪ جيلاتين ، 0.1 ميكرومتر من كل مادة أولية ، و 2.5 وحدة من بوليميراز AmpliTaq DNA polymerase (Perkin-Elmer، Norwalk، CT). تم إجراء تفاعل البوليميراز المتسلسل في ظروف تلدين منخفضة الصلابة: 94 درجة مئوية لمدة دقيقتين ، و 33 درجة مئوية لمدة دقيقتين ، و 72 درجة مئوية لمدة دقيقتين لمدة 6 دورات تليها 31 دورة إضافية بدرجة حرارة تلدين تبلغ 42 درجة مئوية بدلاً من 33 درجة ج. كان التمديد النهائي 10 دقائق عند 72 درجة مئوية. تم تحليل منتجات تفاعل البوليميراز المتسلسل بواسطة الرحلان الكهربي لـ 10 ميكرولتر من خليط التفاعل على هلام الاغاروز بنسبة 1٪.

تسلسل الحمض النووي. تم إجراء التسلسل المباشر لمنتج PCR كما هو موصوف سابقًا (Feng et al. ، 1995 Zheng et al. ، 1995) باستخدام طق طقم تسلسل دورة الصبغ التمهيدي (النظم البيولوجية التطبيقية ، فوستر سيتي ، كاليفورنيا). لتسهيل تسلسل استنساخ (كدنا) ، تم استخدام عمليات الحذف المتداخلة (Henikoff ، 1987). تم تسلسل كل جزء من الحمض النووي مرتين على الأقل في كلا الاتجاهين. تم تجميع contig باستخدام برنامج Geneworks (Intelligenetics ، ماونتن فيو ، كاليفورنيا).

فحص الحيوانات المستنسخة (كدنا). تم تصنيف جزء 0.68 كيلو بايت من تجربة تضخيم PCR الأولية بـ [α- 32 P] dCTP (∼110 تيرابكريل / مليمول) باستخدام نظام وسم الحمض النووي متعدد الجراثيم (Amersham ، Arlington Heights ، IL) وتم استخدامه لفحص a ذبابة الفاكهة رئيس مكتبة cDNA (إيتوه وآخرون ، 1985) في λgt11 ، قدمها بسخاء الدكتور بول سالفاتيرا (معهد بيكمان للأبحاث ، دوارتي ، كاليفورنيا). تم تحديد أربعة استنساخ موجبة عن طريق فحص عالي الصرامة (Sambrook et al. ، 1989) لوحدات تشكيل البلاك 4 × 10 5 (pfu). تم قطع أطول ملحق (4 كيلو بايت) سابقة بمعنى البيئةRI واستنساخه في pBluescript II SK (-) لمزيد من التحليل. يشار إلى هذا الإدخال والجين الذي يشفره باسم DopR99B في جميع أنحاء هذه الورقة.

البقع الشمالية. تم عزل الرؤوس والأجسام والملاحق (الأرجل والهوائيات) من الذباب البالغ المجمد (Schmidt-Nielsen et al. ، 1977). تم تحضير Poly (A) + RNA والبقع كما هو موصوف سابقًا (Feng et al. ، 1995 Zheng et al. ، 1995). تم تشغيل Poly (A) + RNA (10 ميكروغرام / ممر) على هلام فورمالديهايد agarose (0.8 ٪) تغيير طبيعة. تم فحص البقع باستخدام جزء PCR المسمى بـ 32 P 0.68 كيلو بايت مضافًا إلى تركيز نهائي قدره 10 6 cpm / ml. بعد الغسيل عالي الخشونة (Feng et al. ، 1995 Zheng et al. ، 1995) ، تعرضت البقع لأفلام الأشعة السينية لمدة 24 ساعة عند -70 درجة مئوية.

فى الموقع التهجين لكروموسوم الغدد اللعابية.تم تهجين جزء PCR البالغ 0.68 كيلو بايت بيولوجيًا ، وتهجينه إلى غدد لعابية من الغدد اللعابية اليرقية ، وتم توطينه باستخدام مجموعة اكتشاف Gibco (Gaithersburg ، MD) Bluegene كما هو موصوف بواسطة Engels et al. (1985) مع تعديلات طفيفة (Feng et al. ، 1995 Zheng et al. ، 1995).

التعبير في Xenopus البويضات. تم تحضير الحس كرنا في المختبر من استنساخ DopR99B في ناقل pBluescript II SK (-) باستخدام بوليميريز T7 RNA (ستراتاجين ، لا جولا ، كاليفورنيا) بعد خطي البلازميد باستخدام لاأنا (بروميغا ، ماديسون ، ويسكونسن). تم توج النصوص بإضافة 0.75 وحدة من m 7 G (5 ′) ppp (5 ′) G (Boehringer Mannheim ، Indianapolis ، IN) إلى تفاعل نسخ قياسي 150 ميكرولتر (مجموعة Stratagene).

المرحلة الخامسة والسادسة من البويضات من أنثى عذراء بالغة Xenopus laevis تم فصلها يدويًا ووضعها في وسط ND96 معقم [بالمتر المربع: NaCl 96 ، KCl 2 ، CaCl2 1.8 ، مجكل2 1 ، HEPES buffer (pH 7.6) 5 ، يحتوي على 2.4 م بيروفات الصوديوم ، 100 وحدة / مل بنسلين ، 0.1 مجم / مل ستربتومايسين ، 0.2 مجم / مل جنتامايسين]. تم تفكيك البويضات بشكل إنزيمي عن طريق الحضانة في ND96 المحتوي على كولاجيناز (2 مجم / مل) لمدة 30 دقيقة. ثم تم حقن البويضات بـ 50 نانوغرام من ذبابة الفاكهة DopR99B لاستشعار مستقبلات الحمض النووي الريبي (cRNA) وحضنت عند 19 درجة مئوية لمدة 2-5 أيام. تم استخدام البويضات غير المحقونة كعناصر تحكم.

تم إجراء تسجيلات الفيزيولوجيا الكهربية من البويضات باستخدام تقنية مشبك الجهد الكهربائي ثنائي القطب ، عند جهد إمساك 60 مللي فولت ، لقياس تيارات البويضات (Van Renterghem et al. ، 1987). تم دمج البويضات باستمرار مع ND96 أثناء التجارب في درجة حرارة الغرفة ، وأضيفت الأدوية إلى superfusate.

فحوصات المخيم. لمراقبة مستويات cAMP ، تم تحضين البويضات الفردية مسبقًا لمدة 30 دقيقة في ND96 بالإضافة إلى 100 ميكرومتر من أيزوبوتيل ميثيل زانثين (IBMX). تم تحضين البويضات التجريبية لمدة 30 دقيقة أخرى مع التركيز المطلوب من الناهض في نفس الوسط بينما تم تحضين البويضات الضابطة (لقياس مستويات cAMP القاعدية) بالتوازي في نفس الوسط بدون ناهض. بعد الحضانات ، تم تجانس كل بويضة في 500 ميكرولتر من الإيثانول المحمض ، والطرد المركزي لإزالة الجسيمات ، وتبخر المادة الطافية حتى تجف في جهاز طرد مركزي فراغ (Savant ، Farmingdale ، NY). تم أخذ كل عينة في 60 ميكرولتر من المخزن المؤقت للمقايسة ومعايرتها لـ cAMP باستخدام مجموعة مقايسة تجارية (Amersham).

المخدرات. تم الحصول على الأدوية المستخدمة في تصنيف المستقبلات المعبر عنها من المصادر التالية: هيدروكلوريد الدوبامين ، (-) - هيدروكلوريد نوربينفرين ، (-) - إيبينيفرين ، هيدروكلوريد تيرامين ، دل - أوكتوبامين هيدروكلوريد ، 5-هيدروكسيتريبتامين هيدروكلوريد ، (±) - إيزوبروتيرينول هيدروكلوريد ، فينتولامين هيدروكلوريد ، دل-بروبرانولول كانت من سيجما (بول ، دورست ، المملكة المتحدة) ص(+) - SKF-38393 [ص(+) - 1-phenyl-2،3،4،5-tetrahydro- (1H) -3-benzazepine-7،8-diol] ، quineloranedihydrochloride ، [-) - quinpirole hydrochloride ، PD-128،907 [(+) - (4aR، 10bR) -3،4،4a، 10b-tetrahydro4-propyl-2H، 5H- (1) benzopyrano- (4،3-b) -1،4-oxazin-9-رأ-هيدروكلوريد] ،رابطة الدول المستقلة- (Z) -فلوبينثيكسول ثنائي هيدروكلوريد ،ص(+) SCH-23390 [ص(+) - 7 كلورو -8-هيدروكسي-3-ميثيل-1-فينيل-2،3،4،5-رباعي هيدرو-1H-3-بنزيبين هيدروكلوريد] ، S (-) - كبريتيد ، سببيرون هيدروكلوريد ، (+) - هيدروكلوريد بوتاكلامول ، S (-) - هيدروكلوريد إيتكلوبريد ، دومبيريدون ، (+) - بروموكريبتين ميثان سلفونات ، (±) -6-كلورو- APB [(±) -6-chloro-7،8-dihydroxy-3-allyl-1- فينيل-2،3،4،5-رباعي هيدرو-1H-3 بنزازيبين هيدروبروميد] ، ص(+) - 6-برومو- APB (ص(+) - 6-برومو 7 ، 8-ثنائي هيدروكسي-3-أليل-1-فينيل-2،3،4،5-رباعي هيدرو-1H-3-بنزازيبين هيدرو-بروميد) ، (±) -6-كلورو- PB [ (±) -6-chloro-7،8-dihydroxy-1-phenyl-2،3،4،5-tetrahydro-1H-3-benzazepine hydrobromide] و (±) -PPHT [(±) -2- (ن-فينيلثيل-ن-propyl) amino-5-hydroxytetralin hydrochloride] كانت من Research Biochemicals (Natick ، ​​MA).


2 إجابات 2

لقد عملت لفترة طويلة في شركة رائدة في مجال الأجسام المضادة عالية الجودة ، لذلك سأحاول مشاركة بعض تجاربي معك. تتكون عملية صنع جسم مضاد عالي التحديد (سأركز على الأجسام أحادية النسيلة) من ثلاثة أجزاء مهمة - تصميم المستضد والتحصين والاستنساخ والاستنساخ الفرعي والفحص / التحقق من الصحة. كل جزء مهم بمفرده ، وكلما كان الأداء أفضل ، زادت فرصك في النجاح في المراحل النهائية.

لكي يعمل الجسم المضاد ، يجب أن يرتبط على وجه التحديد بهدفه. لن أخوض في جميع التفاصيل هنا ، حيث توجد مؤلفات مفتوحة جيدة حول تصميم المستضد ، لكنك تحتاج أساسًا إلى شيء من شأنه تعزيز استجابة مناعية قوية في المضيف ، ويمنحك مجموعة متنوعة من الحيوانات المستنسخة للاختيار من بينها ، وتكون محددة - لا يجب أن تربط أهدافًا أخرى بجانب البروتين الذي يهمك. هناك العديد من العوامل التي يجب مراعاتها ، بما في ذلك الاستدقاق ، والقابلية للذوبان ، وسهولة الإنتاج (للتحصين والفحص) ، والاعتبارات الجامدة (هل يحجب بروتين أو حمض نووي آخر الموقع المستهدف في الجسم الحي؟)، و اخرين. يمكن تقسيم المستضدات تقريبًا إلى نوعين - الببتيدات (عادة أقل من 20 أو 30 حمض أميني) والبروتينات أو أجزاء البروتين. سترغب على الأرجح في تجربة عدة مستضدات لزيادة احتمالية نجاحك. بعد تصنيع المستضد وتنقيته ، تحتاج إلى وضع جدول تحصين لتهيئة وتعزيز الحيوان (الحيوانات) ، ثم تحديد متى وكيف يتم اختبارها (الفرز) ، وفي أي وقت وكيف يتم حصادها من أجل عملية وحيدة النسيلة.

ثم تأتي عملية الاستنساخ بعد ذلك. يمكن إنشاء الحيوانات المستنسخة من خلال مجموعة متنوعة من الطرق ، بعضها متاح على نطاق واسع ، مثل طرق الورم الهجين المختلفة ، وبعضها مملوك لشركات فردية. استخدمت شركتي السابقة مزيجًا من الاثنين ، اعتمادًا على نوع الحيوان ، باستخدام بعض التقنيات الداخلية الرائعة حقًا والتي تم تحسينها وتوسيعها باستمرار. تعتمد هذه العمليات بشكل كبير على جودة المواد المستخدمة وخبرة المستنسخين. يجب حصاد الخلايا B المدخلة (التي تصنع الأجسام المضادة) ومعالجتها وتخزينها وفقًا لمجموعة من الخطوات الدقيقة للسماح بأكبر عدد من الحيوانات المستنسخة القابلة للحياة. بمجرد الحصول على الخلايا التي تم تخليدها (بعد الاندماج مع الخلايا الشريكة للورم النخاعي في عملية الورم الهجين ، على سبيل المثال) يتم تخفيفها إلى عدد خلايا محدد مسبقًا ومطلية في 96 طبقًا جيدًا ويسمح لها بالتعافي والنمو لبعض الوقت ، حيث يقومون بإفراز الأجسام المضادة في الوسط. يتم بعد ذلك اختبار هذه الوسائط بسرعة (قبل أن تتكاثر الخلايا في البئر) ، ويتم تخفيف الآبار الإيجابية (على أمل) تعليق وحيدة الخلية واستنساخها ، أو تجميدها لاحقًا. يتم إجراء الاختبار الأول بشكل متكرر بواسطة ELISA باستخدام مستضد التحصين ، على الرغم من اعتماده على التطبيق الذي يهمك ، فقد يكون عن طريق الفحص عالي الإنتاجية عبر قياس التدفق الخلوي أو الكيمياء الهيستولوجية المناعية أو التألق المناعي. بعد الاختبار الأولي ، يمكن أن تحدث الخطوات اللاحقة من الاستنساخ الفرعي وإعادة الاختبار بوتيرة أكثر قياسًا ، حيث يمكن تجميد الخلايا إلى أجل غير مسمى بعد توليد كميات كافية من الأجسام المضادة في المادة الطافية.

هذا هو المكان الذي تأتي فيه جودة برنامج الفحص الخاص بك. يجب أن تكون فحوصاتك جيدة التصميم ، وقوية ، وموثقة جيدًا ومؤدية ، ولديها عناصر تحكم إيجابية وسلبية مناسبة حتى تتمكن حقًا من معرفة ما إذا كان هناك استنساخ معين مهم ، أو يؤدي أداءً أفضل من منتج موجود. وهذا يعني الظروف الخاضعة للرقابة والكواشف والبروتوكولات الموحدة ودرجة عالية من التكرار من الفحص إلى الفحص. أيضًا ، لا يمكن التأكيد بشكل كافٍ على ملاءمة ضوابطك. هل لديك عينة بالضربة القاضية أو عينة غير معبرة للمقارنة ، أو طريقة للنظر إلى النشاط الأساسي مقابل النشاط المحرض أو المثبط؟ بالنسبة لـ ChIP ، ما لم يكن لديك جسم مضاد جيد التحكم وزوج تمهيدي للجين الذي يهمك ، كيف ستعرف ما إذا كان الفحص يعمل؟ قد تحصل على نتيجة رائعة بعمل لطخة غربية ترسب مناعي مباشرة ، لكنك لا تزال لا تسحب البروتين المرتبط بالحمض النووي. إذا لم تنتج طريقة ChIP الخاصة بك حمض نووي نظيف ، فقد لا تحصل على الارتباط أبدًا. وإذا لم يكن لديك بروتوكولات مناسبة لتحليل البيانات مع آبار تكرار متعددة ، فقد تضيع الوقت في مطاردة الضوضاء بدلاً من إشارة محددة. بالإضافة إلى ذلك ، إلى جانب اختبار جميع النسخ المستنسخة ، تحتاج أيضًا إلى معايرتها لتحديد تركيز العمل الأمثل. لقد رأيت الكثير من الأجسام المضادة التي تبدو مثل الفضلات عندما اختبرت السوب لأول مرة ، لكنها مخففة 100 أو 1000X فهي نظيفة ومحددة ولا تزال قوية. تحلى بالصبر ، فالاختبار يتطلب الكثير من العمل ويتطلب الكثير من التكرار لتأكيد نتائجك ، لكن الأمر يستحق ذلك في النهاية.

أخيرًا ، بعد كل هذا ، نأمل أن يكون لديك نسخة رائعة تفعل ما تريده أن تفعله ، وأفضل من أي شيء آخر هناك. أنت الآن بحاجة إلى تحديد ما ستفعله به ، لأنه إذا كنت معملًا أكاديميًا وتنشر به ، فإن العالم سيطرق بابك. لا تتهاون في النهاية وقرر أن 100 مل من المادة الطافية ستكون كافية لتستمر إلى الأبد - احفظ الحيوانات المستنسخة وضعها في بنك خلوي ، أو حاول الحصول على صفقة تسويق مع شركة تصنيع حتى لا تضطر إلى ذلك قم بكل العمل!

آمل أن يكون هذا مفيدًا ، ويرجى إعلامي إذا كان لديك أي أسئلة أو استفسارات إضافية.


مناقشة

وحدات pOp6/ نظام LhGR المحفز للجلوكوكورتيكويد المذكور هنا يتيح الحث الفعال والقوي للتعبير الجيني في الأرز (الأشكال 2 ، 5 ، 6 ، 7 ، 8). النظام حساس للغاية ، ويستجيب لتركيزات النانومولار لـ DEX (الشكل 5) ، وهو قابل للطرق المختلفة لتطبيق DEX ليناسب الأغراض المختلفة. على سبيل المثال ، يمكن استخدام الأنسجة المنفصلة (كما في الشكل 2) لفحص خطوط التجديد T 0 من أجل الحث الفعال لتعبير الجينات المحورة ، ويمكن استخدام فحوصات الغمر (كما في الشكل 8) لتحديد أهداف / آثار المصب الفوري للنشاط الجيني المستحث ، والنمو على وسط يحتوي على 0.01 ميكرومتر (كما في الشكل 5) يمكن استخدامه لتحليل تأثير الجين المستحث على تطور الجذر. ومع ذلك ، سيكون الحث المتحكم فيه للجينات أثناء تطوير اللقطة أكثر صعوبة ، لأن تركيزات DEX المطلوبة للحث على pOp6 محفز في اللقاح ، يمنع النمو عند تضمينه في وسط الاستزراع (الأشكال 3 و 4 و أمبير الشكل 6). على الرغم من تضمين IPTG في وسط الاستزراع ، فإنه يخفف من التأثيرات السامة لـ LhGR (الشكلان 4 و 6) ، يجب معايرة التركيزات النسبية لـ DEX مقابل IPTG لكل سطر معدل وراثيًا من أجل تعظيم التعبير الجيني وتقليل عيوب النمو. وهذا هو ، لإخماد ارتباط LhGR الناجم عن DEX بـ لاكوعلى غرار المواقع في جينوم الأرز ، مع السماح بالربط الفعال بـ pOp6 المروج في الجينات المعدلة وراثيا. بشكل حاسم ، شوهد القليل جدًا من التعبيرات من pOp6 محفز في حالة عدم وجود محفز ، والذي سيسمح بنقل الجينات المحورة القاتلة من خلال تجديد نباتات T 0 ، مما يضمن حصادًا ناجحًا للبذور المعدلة وراثيًا T1.

العيوب الشديدة الملحوظة في الأرز pOp6/ كانت الخطوط المعدلة وراثيًا LhGR بعد النمو على 10 ميكرومتر DEX غير متوقعة ، لأنه لم يتم الإبلاغ عن أن تركيزات مماثلة من الستيرويد لها تأثير في pOp6/ سلالات LhGR من التبغ أو الأرابيدوبسيس [5 ، 6]. في الواقع ، فإن pOp6تم تطوير نظام LhGR لأول مرة للتغلب على مشكلة النظام الحالي الذي يحفزه DEX ، والذي يستخدم المنشط النسخي GVG مع ما شابه ذلك GAL4 المروج [23] ، أدى في كثير من الأحيان إلى عيوب النمو في نبات الأرابيدوبسيس والأرز و لوتس جابونيكوس [8 ، 14 ، 15]. على الرغم من أن الأساس الجزيئي لعيوب النمو هذه لم يتم تحديده ، فقد تم اقتراح أن منشط GVG كان ملزمًا بالعناصر التنظيمية لرابطة الدول المستقلة في جينوم النبات الذي كان له تماثل تسلسلي مع GAL4 [15]. يشتمل منشط GVG على مجال ربط الحمض النووي لعامل نسخ الخميرة GAL4 ، ومجال تنشيط بروتين الهربس الفيروسي VP16 ونفس مجال GR كما في LhGR [23]. يمكن استخدام مثبط Gal80 لمعايرة ارتباط GAL4 بعيدًا عن الهدف [24] بنفس الطريقة التي استخدم بها IPTG هنا كمضاد فعال لـ أنا مجال ربط الحمض النووي في LhGR (الأشكال 4 ، 6) ، ولكن جال 80 يجب أن يتم التعبير عن الجين بشكل مشترك في بلانتا وقد يكون من الصعب تعديل النشاط. ال pOp6 /وبالتالي ، فإن نظام LhGR المُبلغ عنه هنا هو الخيار الأفضل حاليًا للاستخدام في الأرز ، مع التحذير من ضرورة التمييز بين التأثيرات المظهرية للتعبير الجيني المستحث عن التأثيرات غير المحددة لـ LhGR ، من خلال المقارنة مع خطوط التحكم التي لها مستويات مماثلة من تعبير LhGR ولكن لا يوجد جين مصلحة المصب pOp6.

نظرًا لاستراتيجية الاستنساخ المعيارية Golden Gate التي تم استخدامها لإنشاء ملف pOp6/ بنيات LhGR المذكورة هنا ، هناك إمكانية لتعديل النظام بسهولة لمزيد من التحسين. على سبيل المثال ، يمكن تحفيز جينات متعددة ذات أهمية في وقت واحد باستخدام وحدة LhGR واحدة و / أو يمكن إضافة محفزات خاصة بالأنسجة للتحكم المكاني في نشاط LhGR. في جميع الحالات ، يجب توخي الحذر عند إدخال الإنترونات في البنى ، حيث أن التسلسلات التنظيمية داخلها قد تعزز التعبير الجيني مع وبدون الحث [25]. يتمثل النهج البديل في إنشاء نظام اصطناعي متعامد مع جينوم الأرز وبالتالي لا يمكن اختراقه من خلال التأثيرات غير المستهدفة لتطبيق DEX. في نظام اصطناعي ، سيتم تصميم المنشطات النسخية مثل dTALEs [26] لربط تسلسلات محفز فريدة غير موجودة في جينوم الأرز ، ومن ثم يتم دمج المنشط في تسلسل GR المستخدم هنا. في الواقع ، يمكن استخدام هذا النهج لتصميم نظام متعامد لأي نوع من أنواع الاختيار.


نتائج

CH1 تحويل نظير الغشاء المخاطي FabA إلى FabG

لتقييم دور مجال CH1 في خصوصية ووظيفة الغشاء المخاطي Ab ، تمت دراسة نسختين من FabA ، وهما 43 و 177. تم الحصول على FabA سابقًا [3] عن طريق فحص مكتبة HESN FabA على المنطقة الممتدة القريبة من الغشاء Clade B gp41 (MPER) P1 [19،20] أو على clade B gp41 المحذوفة من أجل MPER [3] ، على التوالي. على المستوى الجزيئي ، يحتوي FabA 43 على درجة عالية من الطفرات الجسدية ، وأصل سلالة جرثومية ثقيلة السلسلة VH3 مشابه لـ bNAb IgG 10E8 [21] ، و CDRH3 طويل من 22 بقايا ، يتميز بخصائص BNAb IgGs الأخرى [3]. في المقابل ، يحتوي FabA 177 على مستوى منخفض من الطفرات الجسدية في السلسلة الثقيلة ، والتماثل بنسبة 100٪ مع منطقة جينات الخط الجرثومي IGKVID-30 * -01 ، و CDRH3 طبيعي الطول من 11 وحدة بنائية [3]. علاوة على ذلك ، فإن السلسلة الثقيلة FabA 177 تنبع من عائلة VH6 ، وهو أصل سلالة جرثومية لم يرتبط أبدًا بـ BNAb IgGs. تم تحويل كل FabA إلى FabG المقابل عن طريق الهندسة الوراثية ، واستبدال CH1α1 بـ CH1γ1 ، وتنقيته بواسطة كروماتوجرافيا التقارب ، كما هو موضح في قسم المواد والطرق. في كل زوج ، تشترك الأنماط المتماثلة في مجالات VH و VL متطابقة ونفس السلسلة الخفيفة ، والتي تختلف فقط حسب مجال CH1.

ربط وتقارب FabA و FabG لمغلف HIV-1

قمنا أولاً بتقييم ما إذا كان تبديل الفئة يحافظ على خصائص الارتباط الأصلية لـ IgA من خلال مقارنة ربط FabA و FabG بالثلاثي المترابط gp41 المشتق من HIV-1 clade B [20] و gp140 المشتق من HIV-1 clades A و C ، وهما فيروس HIV-1 الرئيسي -1 السلالات منتشرة في جميع أنحاء العالم. لتجنب التحيز الناتج عن مختلف الأجسام المضادة الخاصة بالنمط المتماثل المستخدمة في الكشف ، تم الكشف عن الارتباط بـ gp41 في ELISA باستخدام سلسلة ضوء كابا المضادة للإنسان للفأر [12]. يتعرف FabA 43 و 177 على المناطق المحفوظة وفقًا للتوافق على clade B gp41 من فيروسات مدار R5 و X4 [12]. لقد وجدنا أن كلاً من أزواج FabA و G ترتبط على وجه التحديد بـ clade B gp41 وكذلك بالكتل A و C gp140 بطريقة تعتمد على الجرعة ، ولكن اللافت للنظر بالنسبة لجميع الكسوة ، فإن ربط FabA 43 و 177 يكون أكثر كفاءة مقارنةً بهما كل منها FabG (الشكل 1 أ و 1 ب). ومن ثم ، فإن تركيز FabG 43 أعلى بمقدار 50 ضعفًا (50 ميكروغرام / مل) مطلوب للوصول إلى نفس ارتباط Clade B gp41 لـ FabA 43 (1 ميكروغرام / مل) (الشكل 1 أ). الاختلافات التي لوحظت بين FabA و G 177 أكبر ، حيث تصل إلى 500 ضعف بين الأنماط المتماثلة لصالح FabA (الشكل 1 ب). وبالمثل ، فإن الارتباط بكمية ثابتة من clade A و C gp140 ، يتطلب 10 أضعاف FabA 43 أقل من FabG 43 (الشكل 1A) ، و 50-100 ضعف FabA 177 أقل من FabG 177 (الشكل 1B) ، على التوالي. لا يتعرف Fab-IgA D1.3 الخاص بالليزوزيم [3] وغير ذي الصلة Fab-IgG المستخدم كعنصر تحكم سلبي على أي من clade B gp41 أو clade A و C gp140.

FabA و G للنسخ 43 و 177 ملزمة لمغلف HIV gp41 clades A و B و C بطريقة تعتمد على الجرعة. أ و ب: تم تقييم خصوصية FabA (الخط الصلب) و FabG (الخط المنقط) للكليد A gp140 (أحمر) ، و clade B gp41 (الأزرق) clade C gp41 (الأخضر) بواسطة ELISA. للمقارنة المباشرة بين الأنماط المتشابهة FabA و G ، تم إجراء الكشف باستخدام سلسلة خفيفة مضادة للكابا. يتم رسم الارتباط النوعي (OD450 نانومتر) كدالة لتركيز Fab (ميكروغرام / مل). تمثل القيم متوسط ​​± SEM ، مشتق من 3 تجارب مستقلة تم إجراؤها في نسختين. (أ) فاب 43 ، (ب) فاب 177. ج: تم تقييم خصوصية FabA 43 (الخط الصلب) و FabG 43 (الخط المنقط) للبيبتيد P1 المتقاطع ، أي الكليد A (الأحمر) ، والكليد B (الأزرق) والكليد C (الأخضر) بواسطة ELISA. يتم عرض ممثل واحد من بين ثلاث تجارب مستقلة أجريت في نسختين. D و E: ربط FabA و G للنسخ 43 و 177 بفيروس HIV-1 المصاب CD4 + الخلايا التائية. FabA (قضبان صلبة) و FabG (قضبان فقس) من الحيوانات المستنسخة 43 (د) و 177 (ه) تم تحضينها باستخدام Clade A (أحمر) أو Clade B (أزرق) وكليد C (أخضر) الخلايا المصابة بفيروس نقص المناعة البشرية أو الخلايا غير المصابة كعنصر تحكم سلبي طوال الليل عند 4 درجات مئوية. تم استخدام IgA و IgG غير ذي الصلة كعناصر تحكم سلبية. تم اكتشاف ارتباط محدد باستخدام سلسلة ضوء كابا مترافقة مضادة للإنسان من FITC للسماح بإجراء مقارنة مباشرة بين كل من الأنماط النظيرية FabA و G ، وتم تحليلها بواسطة قياس التدفق الخلوي ، كما هو موضح في قسم المواد والطرق. تمثل القيم النسبة المئوية لـ Fab + ± SEM بين خلايا CD4 + T المصابة بفيروس HIV-1 (Gag-p24 +). كان ربط جميع Fabs بالخلايا غير المصابة ضئيلًا. تم إصلاح ارتباط IgA و IgG غير ذي الصلة بالخلايا المصابة عند 1 ٪ وطرح من قيم الربط المحددة n = 3 تجارب مستقلة. اختبار الطالب ، * = p & lt0.05.

بعد ذلك ، تم استخدام رنين البلازمون السطحي (SPR) في التجارب الحركية لمقارنة تقارب FabA و G مع clade B gp41 أو clade A أو C gp140 المثبت على سطح رقاقة المستشعر. تم تحليل FabA و FabG 43 و 177 بتركيزات مختلفة. نتيجة لذلك (الجدول 1 والشكل S1) ، عندما يعمل clade B gp41 كهدف ، يكون KD 3.62 نانومتر لـ FabA 43 و 21.2 نانومتر لـ FabA 177 مقارنة بـ 1.12 و 1.22 ميكرومتر لـ FabG الخاصة بهم. عندما يعمل clade A و C gp140 كهدف ، فإن KDs هي 6.41 و 4.79 نانومتر لـ FabA 43 مقارنة بـ 500 نانومتر ، ولا يتم قياس أي تقارب لـ FabG 43. يساوي KD 0.29 و 21.5 نانومتر لـ FabA 177 ، بينما يقترن FabG 177 ليس له ألفة قابلة للقياس للمغلفات الفيروسية A أو C.

بشكل عام ، تصل تقاربات مغلفات فيروس نقص المناعة البشرية لجميع الكتل إلى نطاق نانومتر لكل من FabA 43 و 177 نسخة ، على غرار تلك الخاصة بـ bNAbs الأخرى [22] ، بينما تظل في ترتيب μM أو حتى أقل من FabG المقابل ، بالاتفاق مع تجارب ملزمة باستخدام ELISA (الشكل 1). الأهم من ذلك ، بالنسبة لجميع Fabs معًا ، يرتبط التقارب بالربط الذي لاحظته ELISA (spearman r = 0.606 p = 0.0375)

ربط FabA و FabG بالببتيد P1

تم تمييز 35 ببتيد من الأحماض الأمينية P1 على أنها المنطقة الخارجية القريبة من الغشاء الحد الأدنى من الغلاف الفيروسي ، gp41 ، والتي تسمح بربط HIV-1 بجالاكتوسيل سيراميد ، ومستقبلات الغشاء المخاطي HIV-1 ودخول الغشاء المخاطي HIV-1 عن طريق التحول للخلايا [23 –25]. تم استخدام هذه المنطقة شديدة الحفظ كمناعة في لقاح وقائي ضد فيروس نقص المناعة البشرية -1 في كل من تجارب المرحلة الأولى قبل السريرية والسريرية [20،26]. يتم حفظ تسلسل P1 جيدًا بين فيروسات clade B و A بينما تمنع طفرة K670S في فيروس clade C ارتباط bNAb 2F5 IgG [27]. تم الحصول على FabA 43 من خلال فحص مكتبة FabA HESN على clade B P1 وبالتالي روابط FabA 43 إلى clade B P1 [3]. عند دراستها بواسطة الرنين المغناطيسي النووي ، فإن البنية ثلاثية الأبعاد P1 ليست خطية ولكنها تحتوي على حلزونيين مفصولين عن طريق منحنية [28]. وبالتالي قمنا بتقييم بواسطة ELISA ، وقدرة FabA و G 43 على الارتباط بالكليد A و B و C P1 ، نسبيًا كما هو موضح [3]. يرتبط كل من الأنماط النظيرية FabA و G 43 بالكتل A و B و C P1 بطريقة تعتمد على الجرعة (الشكل 1C). اللافت للنظر على النحو الوارد أعلاه ، عندما يتم التعبير عن الببتيد P1 في سياق بروتين كامل (الشكل 1 أ) ، يتعرف FabA 43 على P1 بشكل أكثر كفاءة من FabG المقابل (الشكل 1C). يكون هذا الاختلاف أعلى عندما يكون clade B P1 هو الهدف (مع تغيير 60 ضعفًا من FabA إلى G) ، ولكنه يظل مهمًا (مع تغيير 20 ضعفًا من FabA إلى G) عندما تكون clade A و C أهدافًا (الشكل 1C) . بالإضافة إلى ذلك ، يرتبط FabA و FabG 43 بكفاءة أكبر بالكليد B مقارنة بالكليد A و C P1 (الشكل 1C). لوحظت أيضًا هذه الاختلافات في ربط نظائر Fab بـ P1 من الكتل الثلاثة بواسطة SPR (S2 الشكل).

بشكل عام ، يربط FabA 43 الكليد المتقاطع للوحدة الفرعية P1 gp41 بشكل أكثر كفاءة من نظرائه من FabG مع تقارب في نطاق نانومتر.

يرتبط FabA و FabG بخلايا CD4 + T. المصابة بفيروس نقص المناعة البشرية

قمنا بعد ذلك بتقييم قدرة Fabs على الارتباط بالمغلف الفيروسي في شكله الحاد المتقلب على سطح خلايا CD4 + T المصابة بالكليد A (عزل أولي 92UG031) أو B (عزل JR-CSF) أو فيروس C (أولي) عزل 92BR025). بعد الحضانة طوال الليل عند 4 درجات مئوية مع Fabs المختلفة ، تم تقييم الارتباط عن طريق قياس التدفق الخلوي باستخدام جسم مضاد ثانوي مضاد لسلسلة كابا الخفيفة للسماح بمقارنة النمط النظري المباشر. ترتبط جميع Fabs على وجه التحديد بالخلايا المصابة بفيروس HIV-1 ، على الرغم من أن ارتباط FabGs بالكتلة C والخلايا المصابة بفيروس HIV-1 المصابة أقل بكثير مقارنةً بـ FabAs. ما بين 20 و 40٪ من الخلايا التائية المصابة بفيروس نقص المناعة البشرية المسمى FabA مقارنة بـ 5 و 19٪ لـ FabG (Student’s ر–test، p & lt0.05) (الشكل 1D و 1E). يتعرف FabA 43 على كليد A بشكل أكثر كفاءة من خلايا CD4 + T المصابة بـ Clade B و C (الشكل 1D) ، بينما لم تكن هناك اختلافات واضحة بين الكسوة لـ FabA 177 (الشكل 1E). الأهم من ذلك ، يرتبط ارتباط Fab بالخلايا المصابة بفيروس HIV-1 بتقارب Fab والارتباط بمغلف HIV-1 المقاس بواسطة ELISA (الشكل 1A - 1C) (spearman r = 0.777 p = 0.0156) (الشكل 2F).

فعالية Fab 43 و 177-A و -G المضادة للفيروسات ضد الكليات A و B و C HIV-1. (أ و ب) التثبيط المعتمد على الجرعة لعدوى HIV-1 بوساطة Fab 43 (أ) و Fab 177 (ب) تم تقييمه في اختبار العدوى بدورة واحدة ، باستخدام تلطيخ p24 على خلايا CD4 + T. لكل استنساخ Fab ، تم تحضين FabA (الخط الصلب) و FabG (الخط المنقط) لمدة ساعة واحدة عند 37 درجة مئوية إما مع HIV-1 clade A (أحمر) أو clade B (أزرق) أو مع clade C (أخضر) قبل إضافة خلايا CD4 + T لمدة 36 ساعة. تم استخدام Fab-IgA غير ذي صلة (خط رمادي صلب) و Fab-IgG (خط رمادي منقط) بتركيزات مماثلة كعناصر تحكم سلبية. تم تعريف النسبة المئوية للتحييد ، التي تم تحليلها بواسطة قياس التدفق الخلوي كما هو موضح في قسم المواد والطرق ، على أنها تقليل الخلايا المصابة بـ Gag-p24 + HIV-1 مقارنة بالخلايا المصابة بفيروس HIV-1 في حالة عدم وجود Fab. تمثل القيم متوسط ​​± SEM ، مشتق من 4 تجارب مستقلة على الأقل أجريت في ثلاث نسخ. اختبار الطالب ، * = p & lt0.01 ** = p & lt0.001 *** = p & lt0.00001. و د) تثبيط نقل HIV-1 من الخلايا LCs إلى خلايا CD4 + T ذاتية التي تم تقييمها عن طريق قياس p24 الذي تم إطلاقه بواسطة الثقافات المشتركة للخلايا LCs / T في اليوم الخامس. تم تحضين clade C (الأخضر) مسبقًا باستخدام LCs لمدة ساعتين قبل إضافة Fabs (الخط الصلب FabA ، الخط المنقط FabG) وخلايا CD4 + T. تم استخدام Fab-IgA غير ذي صلة (خط رمادي صلب) و Fab-IgG (خط رمادي منقط) بتركيزات مماثلة كعناصر تحكم سلبية. حضنت زراعة الخلايا LC-T عند 37 درجة مئوية لمدة 7 أيام. اعتبرت مزارع LC-T بدون Fab نقل HIV-1 بنسبة 100٪ من LC إلى خلايا CD4 + T ذاتية. تم تقييم نقل الفيروس عن طريق قياس p24-Ag بواسطة ELISA كما هو موضح في قسم المواد والطرق. تتوافق النتائج مع النسبة المئوية لتثبيط النقل في وجود Fabs. تمثل القيم متوسط ​​± SEM لما لا يقل عن خمس تجارب مستقلة أجريت في ثلاث نسخ. اختبار الطالب ، * = p & lt0.01 ** = p & lt0.01. (هـ) الارتباط بين نشاط تحييد HIV-1 وتثبيط النقل. تم ربط التحييد وتثبيط النقل المقاس لاستنساخ 43 و 177 FabA و G عند 100 نانوغرام / مل. يشار إلى ارتباط رتبة سبيرمان r والقيم المقابلة. (F) الارتباط بين الأداء في كل مقايسة لكل استنساخ 43 و 177. تم الحصول على نسبة القيم التي تم الحصول عليها في كل اختبار محدد لكل من FabA و G المقترنين لكل نسخة ، وتم رسمها كخريطة حرارة باستخدام طريقة تجميع الروابط الكاملة والترتيب وفقًا لإحصاءات سبيرمان. يمثل التجليد 1 / مغلف فيروس نقص المناعة البشرية قيم ELISA OD. التقارب يتوافق مع قيم 1 / سجل دينار كويتي.

خصائص FabA و FabG المضادة للفيروسات

تحييد فيروس HIV-1 CD4 + عدوى الخلايا التائية بواسطة FabA و FabG.

As FabA and G only differ by the CH1 domain, the results presented above suggest that the CH1 domain affects the paratope fitting on the antigen that might, in turn, impact the Ab anti-viral function in an isotype-dependent manner.

Therefore, we first investigated the impact of the CH1 isotype in Fab-neutralizing activities. Using a panel of three viruses from clade A, B and C, neutralization of CD4 + T lymphocytes infection by both FabA and G pairs was tested as previously described [3]. Serial dilutions of each FabA and G were assessed comparatively, and IC50 values were determined for each HIV-1 clade. Comparative evaluation of paired Fab 43 isotypes reveals that FaA 43 neutralizes all three A, B and C clades with a respective IC50 of 1ng, 1μg and 100ng/ml, whereas FabG 43 only neutralizes clade A virus with an IC50 of 100ng/ml but not clades B or C virus (Fig 2A). A similar neutralization pattern is observed for the clone 177 with an IC50 of 1ng, 300ng and 30ng/ml for FabA 177 against clade A, B and C virus respectively and an IC50 of 100ng and 1μg for FabG 177 against clade A and C virus, respectively (Fig 2B). In all cases, the paired FabA has significantly-increased neutralization compared to its paired FabG for all concentrations evaluated (Student’s ر–test, p values ranging from p<0.01 to p<0.00001). Irrelevant Fab-IgA and Fab-IgG, used as negative controls in parallel experiments lack neutralizing. Of note, cross-neutralization of the Fab we report is based on only one isolate of each clade and should be confirmed on more isolate per clade in future studies.

In summary, for all three HIV-1 clades tested, the CH1α confers to FabA the capacity to neutralize CD4 + T-cell infection whereas the corresponding FabG harboring the same paratope but a different CH1, namely CH1γ, has limited neutralizing activities.

Blockade of cell-to-cell virus transfer by FabA and FabG.

Cell-to-cell transmission of HIV-1 is of major importance في الجسم الحي, being much more efficient than infection by cell-free virions [29]. At the mucosal level, HIV-1 entry through multilayer mucosal tissues occurs mainly by targeting Langerhans cells (LCs) that in turn, transfer to CD4 + T-cells [30–33], which constitute the founder-infected cell population. In turn, CD4 + T-cells migrate out of the mucosal tissue, further spreading the virus. Thus, we evaluated the capacity of both pairs of HESN Fabs to block clades A, B and C virus transfer from LCs to CD4 + T-cells. Transfer of clade A and C HIV-1 is inhibited by both FabA 43 and 177 in a concentration-dependent manner, as well as that of clade B by FabA 43, inducing a >40% inhibition at 100ng/ml. Transfer of clade B virus remains much less sensitive to FabA 177 (Fig 2C and 2D). FabG 43 blocks transfer of clade A and C viruses but less efficiently than its FabA counterpart (Fig 2C), and FabG 177 was only able to block clade A HIV-1 transfer (Fig 2D). Irrelevant Fab-IgA and Fab-IgG, used as negative controls, fail to interfere with HIV-1 transfer from LCs to CD4 + T cells.

Of note, taking all the values into consideration (including all viral clades and Fab isotypes) together, at 100ng/ml of Fab, neutralization capacity correlated directly with inhibition of virus transfer (spearman r = 0.6655, p = 0.0219) (Fig 2E).

Taken together, this series of functional analyses demonstrates that switching the CH1α from a mucosal Ab to CH1γ, considerably reduces the Fab antiviral properties, namely both neutralization and HIV-1 transfer from LCs to CD4 + T-cells (Fig 2F).

Identification of FabA- and G-specific mimotopes

The molecular basis by which the CH1 region impacts antibody affinity and functions, could be due to selective molecular stringency/flexibility imposed by the CH1 domain on the paratope conformation. Thus, we aimed to determine the conformational epitopes specific for each Fab isotype, namely clones 43- and 177-specific FabA and FabG.

Consequently, a 12 mer random peptide library was used to characterize a set of the best specific peptides, referred to as mimotopes, of both 43 and 177 clones as FabA and FabG using three rounds of successive screening with increasing stringency, as we have previously described [12]. After sequencing 100 phages specific for each of the Fabs, none of the selected mimotopes correspond to linear sequences of gp41, indicating that Fab epitopes are conformational, as already suggested [3]. Whereas a larger set of mimotopes with high occurrence were retrieved on each of the FabA, a limited number of different phage-expressing peptides bound to FabG, in line with the lower affinity of the FabGs compared with FabAs for gp41 (S1 and S2 Tables).

Conformational FabA and G epitope mapping

The strategy we used to characterize conformational epitopes corresponding to each set of mimotopes, using في السيليكو approaches, is based on mimotope mapping onto trimeric gp41 crystal structures, as described in the Material and Methods section and supplementary data. When experimental techniques such as X-ray crystallography of antibody-antigen interactions turn difficult to use [34], such as in the present case, and when the structure of the target is known, في السيليكو approaches can provide an appropriate means to identify candidate epitopes to be further tested [35], for instance by competition experiments. Only two gp41 crystal structures of a clade B, but not clade A or C gp41, each in a different conformational state, are available. One structure represents gp41 in the pre-fusion state, together with gp120, although this gp41 lacks the MPER region [36]. The other gp41 structure mimics the 6-Helix bundle state and is composed of three N-helices and three C-helices that form a six helix-bundle for completion of HIV-1 fusion with target cells in a “spring-loaded” model of fusion. In this case, the gp41 construct lacks the gp41 Cys-loop bridging the C and N helices [37].

As Fab 43 is primarily specific for the gp41 MPER [3] and the Cys-loop contains important gp41 epitopes [38], we reconstructed في السيليكو the missing parts of clade B gp41 as described in the Material and Methods section using our recently-developed approach [39]. Hence, we first optimized the available crystal structure of gp41 clade B by reconstituting the missing MPER in the pre-fusion structure and the missing loop in the 6-Helix bundle as described in the supplementary data.

Furthermore, as no crystal structures of clade A or C are available in the literature, we constructed clade A and clade C gp41 structures by mapping each of clade A and clade C gp41 sequences onto the clade B gp41 structures, as detailed in the supplementary data. As a result, from these في السيليكو modeling calculations, simulation of clade A, B and C gp41 structures in the pre-fusion and 6-Helix bundle conformations were available for epitope mapping studies.

Selected FabA-specific mimotopes, obtained from FabA 43 and 177, were localized on clade A, B and C gp41 pre-fusion and 6-helix bundle structures, using the PEPsurf method as detailed in supplementary S3 Fig. Two main regions are targeted by FabA 43 mimotopes on gp41 6-helix bundle structure of all three clades, the highest hits being localized on the lower MPER region interface with the N-helix (Fig 3A), in agreement with the screening strategy focusing on P1, used for selecting FabA 43 [3]. In comparison, FabA 43 mimotopes only fit on the clade B pre-fusion structures and with lower scores (Fig 4A). Furthermore, mimotopes fit on each gp41 with slight differences as recapitulated in S3 Table.

Each set of antibody specific mimotopes obtained by biopanning for both isotype FabA clones 43 (أ) and 177 (B) were docked on the crystal structure of gp41 under its 6-Helix bundle conformation. Each gp41 monomer in the trimer is highlighted by a different hue of blue. Epitopes are visualized in a color scale according to the scores returned by the PEPsurf algorithm at each position of the sequence (mean of the 3 chains, over 15 conformations extracted each 10 ns from the molecular dynamic simulations) for each set of mimotope. A common color scale varying from never (yellow) to the most frequent on all clades and structures (red) is used, allowing to directly compare epitopes on the three gp41 clades. For each score, a set of random sequences at each position of the sequence had been subtracted to remove background noise.

Each set of antibody specific mimotopes obtained by biopanning for both isotype FabA clones 43 (أ) and 177 (ب) were docked on the crystal structure of gp41 under its trimeric pre-fusion conformation. Each gp41 monomer in the trimer is highlighted by a different hue of blue. Epitopes are visualized as described in Fig 3 using the same scale to facilitate direct comparison.

The main region targeted by FabA 177 mimotopes on gp41 6-helix bundle structures of all three clades, differs from those targeted by FabA 43 mimotopes, as expected [3]. FabA 177 mimotopes best fit the loop linking the N and C gp41-helices (Fig 3B). These FabA 177-specific mimotopes target an additional domain overlapping the regions mapped by FabA 43 mimotopes, although identified with a much lower score that might not be biologically relevant. Finally, these FabA 177 mimotopes also match gp41 pre-fusion structures as detailed in S2 Table, but with lower scores than the 6-Helix bundle and in a more scattered pattern, irrespective of the clade (Fig 4B) and thus with limited biological relevance.

When FabG sets of specific mimotopes were analyzed similarly, numerous regions were targeted on the various gp41 structures. Corresponding scores might not be relevant biologically, in agreement with the low affinity of FabGs for gp41 and the low number of mimotopes retrieved compared to FabAs. We therefore concentrated our analysis on the FabA 43 and 177 mimotopes.

Design of peptides recapitulating FabA conformational epitopes

To validate experimentally, the FabA conformational epitopes defined في السيليكو as described above, we designed peptides that mimic each conformational FabA epitope and evaluated their capacity to bind their corresponding FabA. To construct these peptides, additional bioinformatic analyses were conducted for each mimotope independently as described in the Material and Methods section.

From these analyses, five peptides specific for FabA 43, namely P7 to P11 could be designed (S4 Table). All of these Fab43 specific peptides appear compatible with the 3-dimensional 6-Helix bundle conformations in all three clades, except P8 which targets only the clade A pre-fusion conformation.

When tested at the biological level for FabA specificity, one out of the five conformational epitopes defined في السيليكو for FabA 43, encompassing regions on both the gp41 N and C-Helixes with LWNWFDISAASI as sequence, and referred to as P7, competes significantly with FabA 43 binding to P1 and gp41/gp140 of the three clades in ELISA when preincubated with the FabA 43 (Figs 5A and S3A) in a concentration-dependent manner (Fig 5B). P7 at 5 μM blocks FabA 43 binding by >50%, reaching >80% at 10μM (Fig 5B). A 9 amino acid peptide derived from the influenza virus hemagglutinin (HA) used as negative control, does not interfere with FabA 43 binding in ELISA (Fig 5A). In contrast, peptide P7 does not interfere with FabG 43 binding to the same antigens (not shown). Taken together, these results indicate that P7 interferes with FabA 43 cross-clade.

(أ) Preincubation of FabA 43 with the conformational epitope P7 (5 μM, hatch bars) but not with control HA (5μM, plain bars) interferes significantly with FabA 43 binding to clade A (red), clade B (blue) and clade C (green) P1 of clades A and C gp140 and clade B gp41, as evaluated by competition ELISA as described in Material and Method section. FabA 43 preincubated with P7 or control HA were added to gp41 clade B, gp140 (clades A, C) or P1 (clades A, B, C) coated on the ELISA and their binding was detected by using HRP-coupled anti-human IgA. The percentage of binding was calculated relative to the binding of Fab in the absence of the P7 or control HA. (ب) The P7-induced reduction of FabA 43 binding to each antigen is dose dependent. Competition ELISA was done in the same conditions described in A. Binding inhibition to FabA 43 binding to each antigen in the presence of P7 is calculated relative to the binding inhibition in the presence of the irrelevant HA peptide serving as negative control. In A and B, values represent mean ± SEM, derived from 3 independent experiments performed in triplicate. ) Localization of the amino acid paths corresponding to P7 peptide on the 6-Helix bundle conformation of clades A, B and C gp41 frame15. Each gp41 monomer of the trimer is depicted using a different level of gray. The amino acid paths corresponding to the FaA 43-specific peptide P7 are highlighted in orange. Note residues 532–535 belong to the N-Helix of one monomer while residues 669–672 belong to the C-Helix of another monomer of the trimer. Red: the P7-predicted conformation, superimposed on the structure of gp41. RMSD values over the paired residues of gp41 and P7 are of 2.45, 2.97 and 1.97 Å for clade A, B and C, respectively. Note that in this region of the gp41, only residue 535 differs between clade B in one hand and clade A and C in the other hand. (د) Conformational variability of the predicted conformations of P7 using PEP-FOLD3. Left: conformation best fitting gp41. Right: top 10 predicted conformations superimposed. (هـ) Interference of FabA 43 neutralization by a 400-fold molar excess of P7 peptide. FabA 43 preincubated with P7 or control HA were incubated with the HIV-1 of one of each three clades (A, B, C) before adding the activated CD4 + T cells, and cultures were incubated at 37°C for 2 days. Cultures without Fab were served as positive control of infection. The percentage of neutralization, analyzed by flow cytometry as indicated in Materials and Methods section, is shown relative to FabA 43 neutralization using primary CD4 + T cells in the presence of the irrelevant HA peptide, tested in parallel. Values represent mean ± SEM, derived from 3 independent experiments performed in triplicate.

The 12 aminoacid peptide P7 recapitulates a region located at the interface formed by the tips of N- and C-helix of the three clades of gp41 (Fig 5C and 5D). Although P7 has been defined as the best conformational epitope extracted by في السيليكو analyses from FabA 43 mimotope fitting to the 6-Helix bundle clade A gp41 structure, this cross-clade reactivity is expected. Hence, the P7- corresponding region in clade B and C is similar in sequence, although it harbors a I535M substitution in clade B. Our predictions support the hypothesis that P7 mimics a patch on gp41 surface involving two different monomers of the gp41 6-Helix bundle, suggesting that FaA 43 could freeze gp41 in the 6-Helix bundle conformation, thereby preventing further conformational changes of the trimer assembly. The other four conformational peptides defined في السيليكو for FabA 43 that do not interfere with FabA 43 binding to the gp41 antigens are located on different regions of gp41, regardless of the gp41 clade. As two of them are spatially close from the region defined by P7 (S4 Fig), it suggests that the region mapped by P7 on gp41 is highly specific for FabA 43 binding to the HIV-1 envelope. Furthermore, at the functional level, preincubation of FabA 43 with a 400- fold molar excess of P7 blocked the FabA 43 HIV-1 clades A, B and C neutralizing activities with an efficacy of 33±5, 54±8, and 24±11%, respectively (Fig 5E). These results are in good agreement with the antigen-binding blockade observed in ELISA (Fig 5A and 5B).

Finally, six conformational epitopes, referred to as P0 to P6, that best mimic each set of mimotopes specific for FabA 177, were also designed for each gp41 conformation and clade (S2 and S3 Tables). The six peptides extracted from this analysis are compatible with the 3D conformations of at least two clades and interfere all, although to different degrees, with FabA 177 binding to gp41/gp140 of clades A, B and C, with a maximal binding inhibition limited to 23% (S3B Fig). However, no interference was observed with FabA 177 neutralizing activity against HIV-1 of clades A, B and C.


16.3 الدورة الدموية والجهاز التنفسي

الحيوانات كائنات معقدة متعددة الخلايا تتطلب آلية لنقل العناصر الغذائية في جميع أنحاء أجسامها وإزالة النفايات. يمتلك الجهاز الدوري للإنسان شبكة معقدة من الأوعية الدموية التي تصل إلى جميع أجزاء الجسم. تزود هذه الشبكة الواسعة الخلايا والأنسجة والأعضاء بالأكسجين والمواد المغذية ، وتزيل ثاني أكسيد الكربون ومركبات النفايات.

وسيط نقل الغازات والجزيئات الأخرى هو الدم ، الذي يدور باستمرار عبر النظام. تؤدي اختلافات الضغط داخل النظام إلى حركة الدم ويتم إنشاؤها عن طريق ضخ القلب.

يعتبر تبادل الغازات بين الأنسجة والدم وظيفة أساسية في الدورة الدموية. في البشر والثدييات والطيور الأخرى ، يمتص الدم الأكسجين ويطلق ثاني أكسيد الكربون في الرئتين. وهكذا يعمل الجهاز الدوري والجهاز التنفسي ، الذي تتمثل وظيفته في الحصول على الأكسجين وتفريغ ثاني أكسيد الكربون ، جنبًا إلى جنب.

الجهاز التنفسي

خذ نفسا واحبسه. انتظر عدة ثوان ثم اتركها. يتنفس البشر ، في حالة عدم إجهاد أنفسهم ، حوالي 15 مرة في الدقيقة في المتوسط. هذا يعادل حوالي 900 نفس في الساعة أو 21600 نفس في اليوم. مع كل شهيق ، يملأ الهواء الرئتين ، ومع كل زفير يندفع للخارج. يقوم هذا الهواء بأكثر من مجرد نفخ وتفريغ الرئتين في تجويف الصدر. يحتوي الهواء على الأكسجين الذي يعبر أنسجة الرئة ، ويدخل مجرى الدم ، وينتقل إلى الأعضاء والأنسجة. هناك ، يتم تبادل الأكسجين لثاني أكسيد الكربون ، وهو مادة نفايات خلوية. يخرج ثاني أكسيد الكربون من الخلايا ، ويدخل إلى مجرى الدم ، ويعود إلى الرئتين ، وينتهي صلاحيته خارج الجسم أثناء الزفير.

التنفس هو حدث طوعي ولا إرادي. يتم تنظيم عدد مرات التنفس ومقدار الهواء الذي يتم استنشاقه أو زفيره من قبل مركز الجهاز التنفسي في الدماغ استجابة للإشارات التي يتلقاها حول محتوى الدم من ثاني أكسيد الكربون. ومع ذلك ، من الممكن تجاوز هذا التنظيم التلقائي لأنشطة مثل التحدث والغناء والسباحة تحت الماء.

أثناء الاستنشاق ينزل الحجاب الحاجز ليحدث ضغطًا سلبيًا حول الرئتين ويبدأان في الانتفاخ ، وسحب الهواء من خارج الجسم. يدخل الهواء الجسم من خلال تجويف الأنف الموجود داخل الأنف (الشكل 16.9). عندما يمر الهواء عبر تجويف الأنف ، يتم تسخين الهواء إلى درجة حرارة الجسم وترطيبه بالرطوبة من الأغشية المخاطية. تساعد هذه العمليات في موازنة الهواء مع ظروف الجسم ، مما يقلل من أي ضرر يمكن أن يسببه الهواء البارد والجاف. يتم إزالة الجسيمات التي تطفو في الهواء في الممرات الأنفية عن طريق الشعر والمخاط والأهداب. يتم أيضًا أخذ عينات من الهواء كيميائيًا عن طريق حاسة الشم.

من تجويف الأنف ، يمر الهواء عبر البلعوم (الحلق) والحنجرة (صندوق الصوت) وهو يشق طريقه إلى القصبة الهوائية (الشكل 16.9). وتتمثل الوظيفة الرئيسية للقصبة الهوائية في تحويل الهواء المستنشق إلى الرئتين وهواء الزفير للخارج من الجسم. القصبة الهوائية البشرية عبارة عن أسطوانة يبلغ طولها حوالي 25 إلى 30 سم (9.8-11.8 بوصة) ، وتقع أمام المريء وتمتد من البلعوم إلى تجويف الصدر إلى الرئتين. وهي مصنوعة من حلقات غير مكتملة من الغضاريف والعضلات الملساء. يوفر الغضروف القوة والدعم للقصبة الهوائية للحفاظ على الممر مفتوحًا. القصبة الهوائية مبطنة بالخلايا التي تحتوي على أهداب وتفرز المخاط. يمسك المخاط الجزيئات التي تم استنشاقها ، وتحرك الأهداب الجزيئات نحو البلعوم.

تنقسم نهاية القصبة الهوائية إلى قصبتين تدخلان الرئة اليمنى واليسرى. يدخل الهواء إلى الرئتين من خلال القصبات الهوائية الأولية. تنقسم القصبات الأولية ، مكونة قصبات ذات قطر أصغر وأصغر حتى يصبح قطر الممرات أقل من 1 مم (0.03 بوصة) عندما تسمى القصيبات لأنها تنقسم وتنتشر عبر الرئة. مثل القصبة الهوائية ، تتكون القصبات الهوائية والقصيبات من الغضاريف والعضلات الملساء. يتم تعصب الشعب الهوائية بواسطة أعصاب كل من الجهاز العصبي السمبثاوي والجهاز السمبثاوي الذي يتحكم في انقباض العضلات (السمبتاوي) أو الاسترخاء (الودي) في الشعب الهوائية والقصيبات ، اعتمادًا على إشارات الجهاز العصبي. القصيبات النهائية هي القصيبات التنفسية. ترتبط القنوات السنخية بنهاية كل قصبة تنفسية. في نهاية كل مجرى توجد أكياس سنخية ، كل منها يحتوي على 20 إلى 30 حويصلة حجرية. يحدث تبادل الغازات فقط في الحويصلات الهوائية. الحويصلات الهوائية رقيقة الجدران وتبدو وكأنها فقاعات صغيرة داخل الأكياس. الحويصلات الهوائية على اتصال مباشر مع الشعيرات الدموية في الدورة الدموية. يضمن هذا الاتصال الحميم أن الأكسجين سينتشر من الحويصلات الهوائية إلى الدم. بالإضافة إلى ذلك ، سينتشر ثاني أكسيد الكربون من الدم إلى الحويصلات الهوائية ليتم الزفير. يؤكد الترتيب التشريحي للشعيرات الدموية والحويصلات الهوائية على العلاقة الهيكلية والوظيفية للجهاز التنفسي والدورة الدموية. تختلف تقديرات مساحة الحويصلات الهوائية في الرئتين بحوالي 100 متر مربع. تبلغ مساحة هذه المنطقة الكبيرة حوالي نصف ملعب تنس. تسمح مساحة السطح الكبيرة هذه ، جنبًا إلى جنب مع الطبيعة رقيقة الجدران للخلايا السنخية ، للغازات بالانتشار بسهولة عبر الخلايا.

اتصال مرئي

أي من العبارات التالية خاطئة عن الجهاز التنفسي البشري؟


Investigations into the Biosynthesis, Regulation, and Self-Resistance of Toxoflavin in Pseudomonas protegens Pf-5

الزائفة النيابة. are prolific producers of natural products from many structural classes. Here we show that the soil bacterium Pseudomonas protegens Pf-5 is capable of producing trace levels of the triazine natural product toxoflavin (1) under microaerobic conditions. We evaluated toxoflavin production by derivatives of Pf-5 with deletions in specific biosynthesis genes, which led us to propose a revised biosynthetic pathway for toxoflavin that shares the first two steps with riboflavin biosynthesis. We also report that toxM, which is not present in the well-characterized cluster of Burkholderia glumae, encodes a monooxygenase that degrades toxoflavin. The toxoflavin degradation product of ToxM is identical to that of TflA, the toxoflavin lyase from Paenibacillus polymyxa. Toxoflavin production by P. protegens causes inhibition of several plant-pathogenic bacteria, and introduction of toxM into the toxoflavin-sensitive strain Pseudomonas syringae DC3000 results in resistance to toxoflavin.

الكلمات الدالة: biocontrol natural products secondary metabolism triazine.


1 المقدمة

أرز (Oryza sativa L.) is a widely consumed staple food feeding over half of population in the world, especially in Asia (Dong et al., ( 2018 )). During the past decades, China has successfully promoted the cultivation of hybrid rice by developing heterosis, which has greatly increased rice yield (Duan et al., 2013 ). In spite of this, developing high-yield new varieties remains one of the major problems concerning rice breeders due to the growing consumer demand, decreased arable land, and the gradually deteriorating environment. Except for yield, the improvement of grain quality and appearance are also important concerns in rice breeding (Peng et al., 2016 ). However, it is inefficient to select those traits based on direct field observation due to their complexity and vulnerability to environmental influences. For example, the rice yield trait depends on the synergy of various factors, including the spikelet number per panicle and panicles per plant, grain weight, grain filling, plant height, and panicle length (Duan, 2013 Shen et al., 2018 ), while the grain appearance quality is essentially determined by grain length, grain width, and grain density (Bazrkar-Khatibani et al., 2019 Lou et al., 2009 ). In recent years, the development of DNA markers and linkage maps enables the molecular breeding of rice to split complex polygenic traits into single Mendelian QTL (Lou et al., 2009 Zhang, Chen, et al., 2017 ).

The genotyping-by-sequencing (GBS) technology is a rapid, simple, and low-cost genotyping method based on the next-generation sequencing and has the capacity of identifying a number of DNA sequences near enzyme cleavage sites and single nucleotide polymorphism (SNP) information for a plant species (Elshire et al., 2012 ). It has been wildly used in the construction of the genetic map, the studies of animal/plant population evolution, and the auxiliary genome assembly (Poland & Rife, 2012 Pootakham et al., 2015 ). The high-throughput SNP genotyping method has also been wildly used in the QTL mapping marker-assisted breeding in rice (Angaji, 2009 Zhang et al., 2017 ). Tang and colleagues characterized the genome-wide SNPs of the parental varieties of recombinant inbred line (RIL) populations using the high-throughput GBS and identified a QTL containing the locus Os4g48460 (a putative cytochrome P450) related to rice seed size (Tang et al., 2016 ). Zhu performed QTL mapping in a restorer line of hybrid rice based on ultra-high-density SNP mapping and found 26 QTLs for six yield traits, in which nine QTL alleles presented a significant effect (Zhu et al., 2017 ). Jiang performed the high-density genetic map in the QTL mapping of 124 rice backcrossed recombinant inbred lines and showed six QTLs related to seed germination in response to the cold stress (Jiang et al., 2017 ).

In this study, the F8 recombinant inbred lines (RILs), developed from the cross Dexiang074B and Pujiang6, were used. Dexiang074B, as a high-combining ability hybrid rice maintainer line, is currently one of the rice backbone parents in Sichuan province and combines high grain quality and yield. Its hybrid progeny, Deyou 4727, passed the national examination and approval in 2014 and was named "green super rice" in 2019. As an indica three-line hybrid rice, this variety is widely planted in the upper and middle reaches of the Yangtze River. It has characteristics of large grains, high seed setting rate, high yield (rice yield is up to 15.0 t/ha), excellent rice quality, and moderate resistance to rice blast. Pujiang6, a farm variety with rounded grain appearance, displays great differences with the economic traits of Dexiang074B. To further understand the genetic basis of agricultural traits in the RILs of rice, including heading data, grain length, grain width, thousand kernel weight, grain density, panicle length, the panicle number, and plant height, we performed genome-wide SNP discovery and QTL mapping for the RIL (F8) population using high-density GBS-based SNP linkage mapping. A total of 426 additive QTLs were identified for the eight agricultural traits with different environments or methods. Importantly, 98 highly reliable QTLs can be detected repeatedly by multiple methods or multiple environments. This study provides a genetic basis for developing cultivated rice with economic characteristics based on the molecular breeding technology.


محتويات

JAK2 gene fusions with the TEL(ETV6) (TEL-JAK2) and PCM1 genes have been found in patients suffering leukemia, particularly clonal eosinophilia forms of the disease. [11] [12] [13]

Mutations in JAK2 have been implicated in polycythemia vera, essential thrombocythemia, and myelofibrosis as well as other myeloproliferative disorders. [14] This mutation (V617F), a change of valine to phenylalanine at the 617 position, appears to render hematopoietic cells more sensitive to growth factors such as erythropoietin and thrombopoietin, because the receptors for these growth factors require JAK2 for signal transduction. An inhibitor of JAK2-STAT5, AZD1480, was pointed as having activity in primary and CRPC. [15] Jak2 mutation, when demonstrable, is one of the methods of diagnosing polycythemia vera. [16]

Janus kinase 2 has been shown to interact with:

Prolactin signals through JAK2 are dependent on STAT5, and on the RUSH transcription factors. [60]


محتويات

Khorana was born to Krishna Devi Khorana and Ganpat Rai Khorana, in Raipur, a village in Multan, Punjab, British India in a Punjabi Hindu family. [9] The exact date of his birth is not certain but he believed that it might have been 9 January 1922 [10] this date was later shown in some documents, and has been widely accepted. [11] He was the youngest of five children. His father was a patwari, a village agricultural taxation clerk in the British Indian government. In his autobiography, Khorana wrote this summary: "Although poor, my father was dedicated to educating his children and we were practically the only literate family in the village inhabited by about 100 people." [12] The first four years of his education were provided under a tree, a spot that was, in effect, the only school in the village. [9]

He attended D.A.V. (Dayanand Anglo-Vedic) High School in Multan, in West Punjab. [9] Later, he studied at the Punjab University in Lahore, with the assistance of scholarships, where he obtained a bachelor's degree in 1943 [12] and a Master of Science degree in 1945. [4] [13]

Khorana lived in British India until 1945, when he moved to England to study organic chemistry at the University of Liverpool on a Government of India Fellowship. He received his PhD in 1948 advised by Roger J. S. Beer. [14] [15] [16] [12] The following year, he pursued postdoctoral studies with Professor Vladimir Prelog at ETH Zurich in Switzerland. [12] He worked for nearly a year on alkaloid chemistry in an unpaid position. [9] [16]

During a brief period in 1949, he was unable to find a job in his original home area in the Punjab. [9] He returned to England on a fellowship to work with George Wallace Kenner and Alexander R. Todd on peptides and nucleotides. [16] He stayed in Cambridge from 1950 until 1952.

He moved to Vancouver, British Columbia, with his family in 1952 after accepting a position with the British Columbia Research Council at University of British Columbia. [12] [17] Khorana was excited by the prospect of starting his own lab, a colleague later recalled. [9] His mentor later said that the Council had few facilities at the time but gave the researcher "all the freedom in the world". [18] His work in British Columbia was on "nucleic acids and synthesis of many important biomolecules" according to the American Chemical Society. [14]

In 1960 Khorana accepted a position as co-director of the Institute for Enzyme research at the Institute for Enzyme Research at the University of Wisconsin at Madison. [14] [19] He became a professor of biochemistry in 1962 and was named Conrad A. Elvehjem Professor of Life Sciences at Wisconsin–Madison. [20] While at Wisconsin, "he helped decipher the mechanisms by which RNA codes for the synthesis of proteins" and "began to work on synthesizing functional genes" according to the American Chemical Society. [14] During his tenure at this University, he completed the work that led to sharing the Nobel prize. The Nobel web site states that it was "for their interpretation of the genetic code and its function in protein synthesis". Har Gobind Khorana's role is stated as follows: he "made important contributions to this field by building different RNA chains with the help of enzymes. Using these enzymes, he was able to produce proteins. The amino acid sequences of these proteins then solved the rest of the puzzle." [21]

He became a US citizen in 1966. [22] Beginning in 1970, Khorana was the Alfred P. Sloan Professor of Biology and Chemistry at the Massachusetts Institute of Technology [23] [12] [24] and later, a member of the Board of Scientific Governors at The Scripps Research Institute. He retired from MIT in 2007. [22]

Har Gobind Khorana married Esther Elizabeth Sibler in 1952. They had met in Switzerland and had three children, Julia Elizabeth, Emily Anne, and Dave Roy.

Ribonucleic acid (RNA) with two repeating units (UCUCUCU → UCU CUC UCU) produced two alternating amino acids. This, combined with the Nirenberg and Leder experiment, showed that UCU genetically codes for serine and CUC codes for leucine. RNAs with three repeating units (UACUACUA → UAC UAC UAC, or ACU ACU ACU, or CUA CUA CUA) produced three different strings of amino acids. RNAs with four repeating units including UAG, UAA, or UGA, produced only dipeptides and tripeptides thus revealing that UAG, UAA, and UGA are stop codons. [25]

Their Nobel lecture was delivered on 12 December 1968. [25] Khorana was the first scientist to chemically synthesize oligonucleotides. [26] This achievement, in the 1970s, was also the world's first synthetic gene in later years, the process has become widespread. [23] Subsequent scientists referred to his research while advancing genome editing with the CRISPR/Cas9 system. [22]

Subsequent research

He extended the above to long DNA polymers using non-aqueous chemistry and assembled these into the first synthetic gene, using polymerase and ligase enzymes that link pieces of DNA together, [26] as well as methods that anticipated the invention of polymerase chain reaction (PCR). [27] These custom-designed pieces of artificial genes are widely used in biology labs for sequencing, cloning and engineering new plants and animals, and are integral to the expanding use of DNA analysis to understand gene-based human disease as well as human evolution. Khorana's invention(s) have become automated and commercialized so that anyone now can order a synthetic oligonucleotide or a gene from any of a number of companies. One merely needs to send the genetic sequence to one of the companies to receive an oligonucleotide with the desired sequence.

After the middle of the 1970s, his lab studied the biochemistry of bacteriorhodopsin, a membrane protein that converts light energy into chemical energy by creating a proton gradient. [28] Later, his lab went on to study the structurally related visual pigment known as rhodopsin. [29]

A summary of his work was provided by a former colleague at the University of Wisconsin: "Khorana was an early practitioner, and perhaps a founding father, of the field of chemical biology. He brought the power of chemical synthesis to bear on deciphering the genetic code, relying on different combinations of trinucleotides." [14] [4]

In addition to sharing the Nobel prize (while he was working at the University of Wisconsin–Madison in the U.S.), [13] Khorana was elected as Foreign Member of the Royal Society (ForMemRS) in 1978. [30] In 2007, the University of Wisconsin–Madison, the Government of India (DBT Department of Biotechnology), and the Indo-US Science and Technology Forum jointly created the Khorana Program. The mission of the Khorana Program is to build a seamless community of scientists, industrialists, and social entrepreneurs in the United States and India.

The program is focused on three objectives: [31] Providing graduate and undergraduate students with a transformative research experience, engaging partners in rural development and food security, and facilitating public-private partnerships between the U.S. and India. The Wisconsin–India Science and Technology Exchange Program (WINStep Forward, WSF) adopted administration responsibilities for the Khorana program in 2007. [32] WINStep Forward was jointly created by Drs. Aseem Ansari and Ken Shapiro at the University of Wisconsin–Madison. WINStep Forward also administers the nationally competitive S.N. Bose Programs for Indian and American students, respectively, to promote both fundamental and applied research not only in biotechnology but broadly across all STEM (science, technology, engineering, and mathematics) fields, including medicine, pharmacy, agriculture, wildlife and climate change.

In 2009, Khorana was hosted by the Khorana Program and honored at the 33rd Steenbock Symposium in Madison, Wisconsin. [19]

Other honors included the Louisa Gross Horwitz Prize from Columbia University and the Lasker Foundation Award for Basic Medical Research, both in 1969, the Golden Plate Award of the American Academy of Achievement in 1971, [33] the Willard Gibbs Medal of the Chicago section of the American Chemical Society, in 1974, the Gairdner Foundation Annual Award, in 1980 and the Paul Kayser International Award of Merit in Retina Research, in 1987. [12]

On 9 January 2018, a Google Doodle celebrated the achievements [34] of Har Gobind Khorana on what would have been his 96th birthday. [35] [36]

Khorana died on 9 November 2011, in Concord, Massachusetts, at the age of 89. His wife, Esther, and daughter, Emily Anne, had died earlier, [14] but Khorana was survived by his other two children. [10] Julia Elizabeth later wrote about her father's work as a professor: "Even while doing all this research, he was always really interested in education, in students and young people." [12]


شاهد الفيديو: حقيقة الاستنساخ. السيد كمال الحيدري (يونيو 2022).


تعليقات:

  1. Cadeo

    حسنا ، ماذا بعد؟

  2. Ordwald

    إنها مجرد جملة رائعة)

  3. Vudozil

    ما هي الكلمات المناسبة ... الفكرة الرائعة والرائعة

  4. Fauzshura

    إنها الشرطية ، إنها ليست أكثر ولا أقل

  5. Kosmy

    إنها مجرد جملة رائعة



اكتب رسالة