معلومة

7.5: دورة اليوريا - علم الأحياء

7.5: دورة اليوريا - علم الأحياء



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

تقوم الدورة بكسح الأمونيا الحرة (مثل أيون الأمونيوم) والتي تكون سامة إذا تراكمت. يتطلب تفاعل الالتقاط أيضًا ATP ، وبيكربونات ، والمنتج عبارة عن فوسفات كربامويل. يتم دمج هذا الجزيء مع الأحماض الأمينية غير البروتينية المعروفة باسم الأورنيثين لصنع حمض أميني آخر غير بروتيني يعرف باسم سيترولين. تؤدي إضافة الأسبارتات إلى السيترولين إلى تكوين الأرجنينوسكسينات ، الذي ينفصل عن الفومارات ، مكونًا الأرجينين (مصدر الأرجينين). إذا لم تكن هناك حاجة للأرجينين ، فيمكن أن يتحلل بالماء لإنتاج اليوريا (تفرز)
أورنيثين ، وبذلك تكتمل الدورة.

تحدث أول تفاعلين موصوفين هنا في الميتوكوندريا وتحدث التفاعلات المتبقية في السيتوبلازم. تشمل جزيئات دورة اليوريا التي تتقاطع مع مسارات أخرى فومارات (دورة حمض الستريك) ، والأسبارتات (استقلاب الأحماض الأمينية) ، والأرجينين (استقلاب الأحماض الأمينية) ، والأمونيا (استقلاب الأحماض الأمينية).


نشاط اليوريا وعلاقته بالمواد العضوية في التربة ، والنيتروجين الميكروبي ، واستيعاب نيتروجين اليوريا بواسطة الذرة في أوكسيسول برازيلي تحت أنظمة عدم الحراثة والحراثة

درسنا العلاقة بين نشاط اليورياز (UA) والمواد العضوية في التربة (SOM) والكتلة الحيوية الميكروبية N (N).بيوم) المحتوى ، واستيعاب سماد اليوريا- N بواسطة الذرة في لاتوسول أحمر داكن (نموذجي Haplustox) مزروعة لمدة 9 سنوات بدون حرث (NT) ، والحرث باستخدام محراث قرصي (DP) ، والحرث باستخدام محراث لوحة التشكيل (MP) . تم أخذ عينات من عمقين من التربة (0-7.5 سم و 7.5-15 سم) في 4 أوقات مختلفة خلال دورة المحاصيل. تم استخدام اليوريا بأربع معدلات مختلفة ، تتراوح من 0 إلى 240 كجم نتروجين هكتار -1. لم تؤثر مستويات السماد N على محتوى UA و SOM و Nبيوم المحتوى. لم يلاحظ أي فرق كبير بين المعالجات (NT ، DP ، و MP) بالنسبة لـ SOM أثناء التجربة ، ربما لأن الجزء الأكبر من SOM كان في أحواض متمردة ، حيث كانت المنطقة مزروعة سابقًا (الحرث التقليدي) لمدة 20 عامًا. من ثمبيوم أوضح المحتوى 97٪ و 69٪ من الاختلاف في UA في الطبقة العليا والأعمق من التربة ، على التوالي. كانت UA والكتلة الحيوية N أعلى بشكل ملحوظ في نظام NT مقارنة بأنظمة DP و MP. ولوحظ أيضًا أعلى إنتاجية للذرة وانتعاش اليوريا- N في نظام NT. لاحظنا أن الزيادة في خسائر اليوريا- N تحت NT ، ربما كنتيجة لارتفاع UA ، تم تعويضها عن طريق الزيادة في N المجمدة في الكتلة الحيوية.

هذه معاينة لمحتوى الاشتراك ، والوصول عبر مؤسستك.


سماد اليوريا

تستخدم الصناعة الزراعية اليوريا على نطاق واسع ، وهي مادة صلبة بلورية بيضاء تحتوي على 46 في المائة من النيتروجين كمادة مضافة للعلف الحيواني وسماد. هنا ، سنركز على دورها كسماد نيتروجين.

في العقد الماضي ، تجاوزت اليوريا نترات الأمونيوم وحلت محلها تقريبًا كسماد. أثار هذا أسئلة جديدة حول اليوريا وكيفية استخدامها.

أساسيات سماد اليوريا

يمكنك شراء سماد اليوريا على شكل حبيبات أو كمادة حبيبية.

في الماضي ، كان يتم إنتاجه عادةً عن طريق إسقاط اليوريا السائلة من برج التحبيب أثناء تجفيف المنتج. شكلت الحبوب مادة أصغر وأنعم من المواد الأخرى التي يشيع استخدامها في خلطات الأسمدة.

اليوم ، يتم تصنيع كمية كبيرة من اليوريا على شكل حبيبات. الحبيبات أكبر وأصعب وأكثر مقاومة للرطوبة. ونتيجة لذلك ، أصبحت حبيبات اليوريا مادة أكثر ملاءمة لمزيج الأسمدة.

يمكنك وضع اليوريا على التربة كمحلول صلب أو ، في بعض المحاصيل ، كرذاذ ورقي.

الاستخدام ينطوي على مخاطر قليلة أو معدومة حريق أو انفجار.

يساعد تحليل اليوريا العالي - 46 بالمائة N - على تقليل تكاليف المناولة والتخزين والنقل مقارنة بأشكال N الجافة الأخرى.

ينتج عن تصنيع اليوريا القليل من الملوثات إلى البيئة.

عندما يتم تطبيقه بشكل صحيح ، فإنه يؤدي إلى زيادة غلة المحاصيل مساوية لأشكال النيتروجين الأخرى.

يمكن أن يفقد النيتروجين من اليوريا في الغلاف الجوي إذا بقيت اليوريا المخصبة على سطح التربة لفترات طويلة من الوقت أثناء الطقس الدافئ.

مفتاح استخدام اليوريا بكفاءة هو دمجها في التربة أثناء عملية الحراثة. يمكنك أيضًا مزجه في التربة بمياه الري. يكفي 0.25 بوصة من الأمطار لمزج اليوريا بعمق كافٍ في التربة حتى لا تحدث خسائر في الأمونيا.

يبدأ تكسير اليوريا بمجرد وضعها على التربة. إذا كانت التربة جافة تمامًا ، فلن يحدث أي تفاعل.

ولكن مع إنزيم اليورياز ، بالإضافة إلى أي كمية صغيرة من رطوبة التربة ، تتحلل اليوريا عادةً وتتحول إلى الأمونيوم وثاني أكسيد الكربون. يمكن أن يحدث هذا في غضون يومين إلى أربعة أيام ويحدث بسرعة أكبر في التربة ذات درجة الحموضة العالية.

ما لم تمطر ، يجب أن تدمج اليوريا خلال هذا الوقت لتجنب فقدان الأمونيا. قد تكون الخسائر منخفضة جدًا في الربيع إذا كانت درجة حرارة التربة باردة.

ثاني أكسيد الكربون (NH2) 2 + H2O + اليورياز → 2NH3 + CO2 (يوريا)

المشكلة هي NH3 ، لأنه غاز. ومع ذلك ، إذا تم دمجها ، فإنها تعمل بنفس طريقة عمل الأمونيا اللامائية المدمجة. أيضا ، نصف 28 في المئة من النيتروجين السائل هو اليوريا. يحدث نفس الشيء مع هذا النصف كما هو الحال مع اليوريا العادية.

فقدان اليوريا بسبب درجة حرارة التربة ودرجة الحموضة

يعتمد تقلب اليوريا إلى حد كبير على درجة حرارة التربة ودرجة حموضة التربة. يوضح الجدولان 1 و 2 أنه بعد أيام قليلة ، قد تتسبب درجات الحرارة الدافئة أو ارتفاع درجة الحموضة في حدوث خسائر.

الجدول 1: تأثير درجة الحرارة على خسائر اليوريا

أيام 45 ف 60 ف 75 ف 90 ف
0 يوم 0٪ من النيتروجين المضاف متطاير 0٪ من النيتروجين المضاف متطاير 0٪ من النيتروجين المضاف متطاير 0٪ من النيتروجين المضاف متطاير
2 أيام 0٪ من النيتروجين المضاف متطاير 0٪ من النيتروجين المضاف متطاير 1٪ من النيتروجين المضاف متطاير 2٪ من النيتروجين المضاف متطاير
4 أيام 2٪ من النيتروجين المضاف متطاير 2٪ من النيتروجين المضاف متطاير 4٪ من النيتروجين المضاف متطاير 5٪ من النيتروجين المضاف متطاير
6 أيام 5٪ من النيتروجين المضاف متطاير 6٪ من النيتروجين المضاف متطاير 7٪ من النيتروجين المضاف متطاير 10٪ من النيتروجين المضاف متطاير
8 أيام 5٪ من النيتروجين المضاف متطاير 7٪ من النيتروجين المضاف متطاير 12٪ من النيتروجين المضاف متطاير 19٪ من النيتروجين المضاف متطاير
10 أيام 6٪ من النيتروجين المضاف متطاير 10٪ من النيتروجين المضاف متطاير 14٪ من النيتروجين المضاف متطاير 20٪ من النيتروجين المضاف متطاير

يوضح الجدول النسبة المئوية لليوريا المضافة على السطح المتطايرة على شكل أمونيا عند درجات حرارة مختلفة وأيام على السطح. تمت إضافة اليوريا على تربة طينية طينية عند 100 رطل من N.

الجدول 2: تأثير درجة حموضة التربة على فقد اليوريا

أيام درجة حموضة التربة - 5.0 درجة حموضة التربة 5.5 درجة حموضة التربة - 6.0 درجة حموضة التربة - 6.5 درجة حموضة التربة - 7.0 درجة حموضة التربة - 7.5
0 0 من N المضافة المتطايرة 0 من N المضافة المتطايرة 0 من N المضافة المتطايرة 0 من N المضافة المتطايرة 0 من N المضافة المتطايرة 0 من N المضافة المتطايرة
2 0 من N المضافة المتطايرة 0 من N المضافة المتطايرة 0 من N المضافة المتطايرة 0 من N المضافة المتطايرة 1 من N المضافة المتطايرة 5 من N المضافة المتطايرة
4 1 من N المضافة المتطايرة 2 من N المضافة المتطايرة 5 من N المضافة المتطايرة 10 من N مضاف متطاير 18 من N المضافة المتطايرة 20 من N المضافة المتطايرة
6 4 من N المضافة المتطايرة 5 من N المضافة المتطايرة 7 من N المضافة المتطايرة 11 من N المضافة المتطايرة 23 من N المضافة المتطايرة 30 من N المضافة المتطايرة
8 8 من N المضافة المتطايرة 9 من N المضافة المتطايرة 12 من N المضافة المتطايرة 18 من N المضافة المتطايرة 30 من N المضافة المتطايرة 33 من N المضافة المتطايرة
10 8 من N المضافة المتطايرة 10 من N مضاف متطاير 13 من N المضافة المتطايرة 22 من N المضافة المتطايرة 40 من N المضافة المتطايرة 44 من N المضافة المتطايرة

يوضح الجدول النسبة المئوية لليوريا المضافة على السطح المتطايرة مثل الأمونيا عند مستويات مختلفة من الأس الهيدروجيني للتربة والأيام على السطح. تمت إضافة اليوريا على تربة الطمي عند 100 رطل من النيتروجين للفدان.

وضع اليوريا وتخزينها

مقارنات الخريف والربيع

يمكن نترت اليوريا بسهولة - أي تحويلها إلى نترات (NO3) - حتى عند تطبيقها في أواخر الخريف ، ويمكن أن تكون عرضة لنزع النتروجين أو النض في الربيع التالي. الأمونيا اللامائية (AA) المطبقة في الخريف لا تتزوج بالسرعة نفسها ، بسبب تقزم الكائنات الحية الدقيقة في نطاق تطبيق AA.

قارنت دراسة لمدة عامين أجريت في Waseca تطبيقات أواخر أكتوبر لكل من AA واليوريا للذرة المستمرة (الجدول 3).

تظهر البيانات ميزة 6 بوشل لكل فدان لـ AA على اليوريا عند تطبيقها في الخريف بدون مثبط النترجة. ولكن عندما تمت إضافة N-Serve ، أظهرت AA ميزة 16 بوشل لكل فدان. يشير هذا إلى أن المانع لديه درجة تلامس أفضل مع مزيج AA مقارنة بما هو ممكن مع اليوريا.

الجدول 3: الغلات بعد تطبيق الأمونيا اللامائية (AA) واليوريا

ن المصدر تقع الخريف
AA (82٪ N) 162 بوشل للفدان 168 بوشل للفدان
AA + N- يخدم 170 بوشل للفدان 172 بوشل للفدان
اليوريا (45٪ ن) 156 بوشل لكل فدان 164 بوشل للفدان
اليوريا + N- يخدم 154 بوشل للفدان 162 بوشل للفدان

يوضح الجدول غلة الذرة متأثرة بمصدر N ووقت التطبيق ومثبط النترجة في Waseca. تتراوح أرقام العائد في المتوسط ​​من 1981 إلى 1982 ، بعد تطبيق 150 رطلاً من N لكل فدان.

أجريت الدراسات التي تستخدم اليوريا بشكل مستمر في لامبرتون منذ عام 1960. وبلغ متوسط ​​إنتاجية الذرة على مدى 24 عامًا من 5 إلى 6 بوشل لكل فدان أعلى مع الاستخدام الربيعي لليوريا مقارنةً بالتطبيق في الحرث الخريف (الجدول 4).

الجدول 4: المحصول يتأثر بتطبيقات اليوريا في الخريف والربيع

الوقت / طريقة تطبيق اليوريا متوسط ​​العائد 24 سنة
سقوط محروث 97 بوشل لكل فدان
الربيع ، يرتدون ملابس علوية 102 بوشل لكل فدان
الربيع ، الجانب 103 بوشل لكل فدان

يوضح الجدول محاصيل الذرة بعد تطبيق 80 رطلاً من النيتروجين لكل فدان في لامبرتون.

لم تكن اليوريا المطبقة في الخريف فعالة مثل AA. هذا صحيح بشكل خاص في جنوب وسط مينيسوتا وأيوا.

عندما تكون ظروف رطوبة التربة جافة ، يكون هناك اختلاف بسيط بين AA واليوريا. ولكن عندما يكون محتوى رطوبة التربة مرتفعًا ، فإن تطبيقات سقوط اليوريا لا تؤدي أداءً جيدًا مثل AA. لا يُنصح بتطبيق نترات اليوريا والأمونيوم (UAN) في الخريف بسبب النترجة السريعة واحتمالية الفقد العالية.

إذا تم تطبيق اليوريا والأسمدة التي تحتوي على اليوريا بشكل صحيح ، فهي مصادر ممتازة للنيتروجين لإنتاج المحاصيل.

تفاعلات كيميائية

بعد التطبيق على التربة ، تخضع اليوريا لتغيرات كيميائية وتتشكل أيونات الأمونيوم (NH4 +). تحدد رطوبة التربة مدى سرعة حدوث هذا التحويل.

عندما يذوب جزيء اليوريا ، تصبح المنطقة المحيطة به منطقة ذات درجة حموضة عالية وتركيز الأمونيا. يمكن أن تكون هذه المنطقة سامة للغاية لبضع ساعات. يمكن للأمونيا الحرة التي تكونت أن تقتل البذور وجذور الشتلات داخل هذه المنطقة.

لحسن الحظ ، يتم تحييد هذه المنطقة السامة في معظم أنواع التربة حيث تتحول الأمونيا إلى أمونيوم. عادة ما يستغرق الأمر بضعة أيام فقط قبل أن تتمكن النباتات من استخدام النيتروجين بشكل فعال.

على الرغم من أن اليوريا تضفي تفاعلًا قلويًا عند وضعها لأول مرة على التربة ، فإن التأثير الصافي هو إنتاج تفاعل حمضي.

كيف ومقدار التقديم

يجب بث اليوريا أو المواد المحتوية على اليوريا بشكل عام ودمجها على الفور في التربة.

إذا كنت تستخدم سمادًا أساسه اليوريا في شريط ، فافصله عن البذور بمقدار 2 بوصة على الأقل من التربة. لا ينبغي تحت أي ظرف من الظروف وضع اليوريا أو الأسمدة القائمة على اليوريا مع بذور الذرة.

مع الحبوب الصغيرة ، يمكنك عمومًا استخدام 10 أرطال من النيتروجين مثل اليوريا باستخدام مثقاب الحبوب في وقت البذر ، حتى في ظل الظروف الجافة. في ظروف الرطوبة الجيدة ، يمكنك استخدام 20 رطلاً من النيتروجين مثل اليوريا باستخدام مثقاب الحبوب.

نتائج البحث

تشير الأبحاث من جامعة ولاية داكوتا الشمالية إلى أنه في ظل الظروف الجافة ، يمكن أن تقلل اليوريا من القمح بنسبة تزيد عن 50 في المائة (الجدول 5). كان هذا بالنسبة لليوريا المطبقة مع مثقاب الحبوب بمسافة 6 بوصات ، بمعدل أكثر من 20 رطلاً من النيتروجين لكل فدان.

تشير أبحاث جامعة ويسكونسن إلى أن تناول بذور اليوريا مع الذرة ، حتى عند معدلات منخفضة من النيتروجين ، شديدة السمية للبذور وتقلل بشكل كبير من الغلة (الجدول 6). ومع ذلك ، عندما تم وضع اليوريا جنبًا إلى جنب كبداية 2 × 2 بوصة ، لاحظ الباحثون القليل من الضرر ، إن وجد (الجدول 7).

في ولاية مينيسوتا ، يتطلب الإنتاج الجيد للمحاصيل عادةً استخدام أكثر من 20 رطلاً من النيتروجين لكل فدان. يمكن للمزارعين تجنب الضرر الناجم عن اليوريا عن طريق بث معظم سماد اليوريا النيتروجين قبل البذر. تشير البيانات الواردة في الجدول 8 إلى أن بث اليوريا قبل البذر يساوي أو أكثر فعالية من معالجات نترات الأمونيوم المماثلة.

الجدول 5: نترات الأمونيوم الموضوعة في البذور (AN) ومقارنات اليوريا

N (رطل لكل فدان) مصدر N أبسراكا ، ن. ويليستون ، ن. كاسلتون ، ن.
0 رطل - 600 شتلة لكل 40 قدم من الصف 270 شتلة لكل 40 قدم من الصف 760 شتلة لكل 40 قدم من الصف
20 رطلا AN 570 شتلة لكل 40 قدم من الصف 220 شتلة لكل 40 قدم من الصف 600 شتلة لكل 40 قدم من الصف
30 رطلا AN 590 شتلة لكل 40 قدم من الصف 240 شتلة لكل 40 قدم من الصف 690 شتلة لكل 40 قدم من الصف
40 رطلا AN 590 شتلة لكل 40 قدم من الصف 260 شتلة لكل 40 قدم من الصف 660 شتلة لكل 40 قدم من الصف
20 رطلا اليوريا 400 شتلة لكل 40 قدم من الصف 200 شتلة لكل 40 قدم من الصف 550 شتلة لكل 40 قدم من الصف
30 رطلا اليوريا 280 شتلة لكل 40 قدم من الصف 110 شتلة لكل 40 قدم من الصف 430 شتلة لكل 40 قدم من الصف
40 رطلا اليوريا 220 شتلة لكل 40 قدم من الصف 70 شتلة لكل 40 قدم من الصف 220 شتلة لكل 40 قدم من الصف

الجدول 6: كيف تؤثر اليوريا ونترات الأمونيوم الموضوعة مع البذور على محصول حبوب الذرة

جنيه لكل فدان غلة اليوريا محصول نترات الأمونيوم
0 رطل 137 بوشل للفدان 137 بوشل للفدان
5 رطل 60 بوشل لكل فدان 142 بوشل لكل فدان
10 رطل 36 بوشل لكل فدان 143 بوشل لكل فدان
20 رطلا 33 بوشل لكل فدان 92 بوشل لكل فدان

الجدول 7: كيف تؤثر اليوريا ونترات الأمونيوم على محصول حبوب الذرة

جنيه لكل فدان غلة اليوريا محصول نترات الأمونيوم
0 رطل 142 بوشل لكل فدان 142 بوشل لكل فدان
25 رطلا 145 بوشل للفدان 145 بوشل للفدان
50 رطلا 146 بوشل للفدان 146 بوشل للفدان
100 رطل 150 بوشل للفدان 141 بوشل لكل فدان

الجدول 8: كيف يؤثر مصدر اليوريا ونترات الأمونيوم على محصول الذرة

جنيه لكل فدان علاج او معاملة مصدر متوسط ​​العائد
0 رطل - - 62 بوشل لكل فدان
40 رطلا محراث: سقوط نترات الأمونيوم 79 بوشل لكل فدان
40 رطلا محراث: سقوط اليوريا 86 بوشل لكل فدان
40 رطلا السطح: سقوط نترات الأمونيوم 82 بوشل لكل فدان
40 رطلا السطح: سقوط اليوريا 85 بوشل لكل فدان
80 رطلا محراث: سقوط نترات الأمونيوم 98 بوشل لكل فدان
80 رطلا محراث: سقوط اليوريا 97 بوشل لكل فدان
160 رطلا محراث: سقوط نترات الأمونيوم 104 بوشل لكل فدان
160 رطلا محراث: سقوط اليوريا 105 بوشل لكل فدان
40 رطلا Topdress: الربيع نترات الأمونيوم 89 بوشل لكل فدان
40 رطلا Topdress: الربيع اليوريا 88 بوشل لكل فدان
80 رطلا Topdress: الربيع نترات الأمونيوم 100 بوشل لكل فدان
80 رطلا Topdress: الربيع اليوريا 102 بوشل لكل فدان

ينتشر بكميات كبيرة ويمزج ويسوائل

انتشار اليوريا

يمكن أن تنتشر اليوريا بكميات كبيرة ، إما بمفردها أو ممزوجة مع معظم الأسمدة الأخرى. يوصى بألا يتجاوز عرض الانتشار 50 قدمًا عند الدمج مع مواد الأسمدة الأخرى.

غالبًا ما تحتوي اليوريا على كثافة أقل من الأسمدة الأخرى التي تمتزج بها. ينتج عن هذا النقص في الوزن مسافة رمي أقصر عند استخدام السماد بمعدات من النوع الدوار. في الحالات القصوى ، سيؤدي ذلك إلى نمو غير متساوٍ للمحاصيل وحقول مموجة أو مخططة.

مزج اليوريا مع الأسمدة الأخرى

يمكن مزج اليوريا والأسمدة المحتوية على اليوريا بسهولة تامة مع فوسفات الأمونيوم الأحادي (11-52-0) أو فوسفات ثنائي الأمونيوم (18-46-0).

لا تخلط اليوريا مع السوبر فوسفات ما لم تطبق بعد وقت قصير من الخلط. تتفاعل اليوريا مع الفوسفات الفوسفات ، وتطلق جزيئات الماء وتنتج مادة رطبة يصعب تخزينها وتطبيقها.

اليوريا السائلة

يعد تجانس حجم الجسيمات مهمًا مع اليوريا الصلبة الجافة ، سواء تم تطبيقها مباشرة أو في تركيبات ممزوجة.

يبدو أن بعض اليوريا المستوردة أقل من معايير الجودة الأمريكية فيما يتعلق بتوحيد الحبيبات. إذابة اليوريا وتسويق المحلول السائل هو محاولة للتغلب على هذا النقص في التوحيد مع الاستفادة من سعر اليوريا المناسب.

المزيج السائل من اليوريا ونترات الأمونيوم (UAN 28 بالمائة N) موجود في السوق لفترة طويلة. ومع ذلك ، فإن خصائص المحلول ليست هي نفسها عند إذابة اليوريا وحدها في الماء.

ينتج عن محلول 50 بالمائة من اليوريا بالوزن 23-0-0 ودرجة حرارة تمليحها تبلغ 60 درجة فهرنهايت. لتخزين ومعالجة اليوريا السائلة أثناء درجات الحرارة المنخفضة ، يجب خفض تركيز النيتروجين لتقليل مشاكل التمليح. يمكن استخدام العديد من الصيغ الممكنة لهذا الغرض ، مثل إضافة كميات صغيرة من نترات الأمونيوم أو كبريتات الأمونيوم أو الأمونيا اللامائية.

البحث ، وخاصة على اليوريا السائلة ، محدود للغاية. بشكل عام ، عندما تعمل اليوريا الجافة بنجاح ، يجب أن تعمل اليوريا السائلة بشكل جيد على قدم المساواة وقد تتمتع بميزة التوحيد الأفضل على بعض مصادر اليوريا الجافة.

يمكن أن يسبب Biuret في اليوريا مشاكل زراعية إذا تم وضعه بالقرب من البذرة ، أو حتى إذا تمت إضافته للزراعة المسبقة في مجموعات حيث ستُزرع البذور لاحقًا.

Biuret في عملية التصنيع

يحافظ معظم مصنعي اليوريا في الولايات المتحدة على محتوى البيوريت منخفضًا عن طريق الحفاظ على درجات حرارة عالية عند الحد الأدنى. عادةً ما يكون محتوى Biuret حوالي 0.3 في المائة ، على الرغم من أن اليوريا ذات المنشأ الأجنبي تبدو أعلى.

ارتفاع الحرارة أمر طبيعي أثناء تصنيع اليوريا. إذا تجاوزت الحرارة 200 درجة فهرنهايت ، فهناك تحول طفيف لليوريا إلى بيوريت ، ولكن هذا يحدث فقط أثناء عملية التصنيع. لا يحدث مثل هذا التحويل في التخزين أو في التربة.

ضرر محتمل

يتحول Biuret إلى أمونيا ، لكن التحويل يكون أبطأ بكثير من تحويل اليوريا. نظرًا لأن البيوريت يبقى في التربة لعدة أسابيع ، فإن احتمال تلف البذور يستمر إلى ما بعد الفترة القصيرة من تحول اليوريا إلى الأمونيا.

ضرر Biuret الرئيسي هو إنبات البذور. هناك ضرر ضئيل من خلال امتصاص النبات ، على الرغم من تضرر بعض محاصيل الحمضيات.

التقديم على زراعة المحاصيل

يمكن تطبيق اليوريا على المحاصيل الحمضية أو القمح الشتوي أو الحبوب الصغيرة الأخرى. ومع ذلك ، اجعل هذا التطبيق في المواسم الباردة. خلال الفترات الدافئة (60 درجة فهرنهايت أو أعلى) ، تميل اليوريا عند ملامستها للمواد النباتية إلى إنتاج الأمونيا.

إذا كان يجب تطبيق اليوريا على المراعي العشبية في الصيف ، فقم بتطبيقه عندما يكون هناك احتمال كبير لسقوط الأمطار.

البخاخات الورقية

يمكنك أيضًا رش اليوريا كرذاذ ورقي على بعض المحاصيل ، مثل البطاطس والقمح والخضروات وفول الصويا.

اليوريا شديدة الذوبان في الماء. في درجات حرارة الغلاف الجوي العادية ، يمكن إذابة حوالي 1 رطل من اليوريا في رطل واحد من الماء.

تشير الأبحاث إلى أن اليوريا يجب ألا تحتوي على أكثر من 0.25٪ بيوريت للاستخدام في البخاخات الورقية. بالنسبة للعديد من المحاصيل ، يجب ألا تتجاوز كمية النيتروجين المطبقة في وقت واحد 20 رطلاً من النيتروجين لكل فدان.

اليوريا ليست قابلة للاحتراق أو الانفجار. في ظل الظروف العادية ، يمكن تخزينه بأمان دون فقدان الجودة.

نصائح التخزين

لا تستخدم مثاقب صغيرة أو سريعة الحركة لتحريك اليوريا الحبيبية. تكون جزيئات اليوريا بشكل عام لينة ويمكن أن يكسر التآكل الحبيبات. استخدم الحزام الناقل كلما أمكن ذلك.

أيضًا ، لا تقم بتخزين اليوريا مع نترات الأمونيوم. عند التلامس ، تمتص هذه المواد الماء بسرعة عندما تزيد الرطوبة النسبية عن 18 بالمائة. يشير الجدول 9 إلى الرطوبة النسبية التي تمتص فيها اليوريا ونترات الأمونيوم الرطوبة من الهواء.


محتويات

تحرير التأين

عندما يذوب حمض الجلوتاميك في الماء ، فإن المجموعة الأمينية (- NH
2 ) قد يكتسب بروتونًا (H +
) ، و / أو قد تفقد مجموعات الكربوكسيل البروتونات ، اعتمادًا على حموضة الوسط.

في البيئات الحمضية بدرجة كافية ، تكتسب المجموعة الأمينية بروتونًا ويصبح الجزيء كاتيونًا بشحنة موجبة واحدة ، HOOC − CH (NH +
3 ) - (CH
2 )2− COOH. [7]

عند قيم الأس الهيدروجيني بين حوالي 2.5 و 4.1 ، [7] يفقد حمض الكربوكسيل الأقرب إلى الأمين عمومًا بروتونًا ، ويصبح الحمض هو zwitterion المتعادل - OOC - CH (NH +
3 ) - (CH
2 )2− COOH. هذا أيضًا شكل المركب في الحالة الصلبة البلورية. [8] [9] التغيير في حالة البروتون تدريجي حيث يكون الشكلين بتركيزات متساوية عند الرقم الهيدروجيني 2.10. [10]

عند درجة حموضة أعلى ، تفقد مجموعة حمض الكربوكسيل الأخرى بروتونها ويوجد الحمض بالكامل تقريبًا مثل أنيون الغلوتامات - OOC − CH (NH +
3 ) - (CH
2 )2−COO - ، بشحنة سالبة واحدة بشكل عام. يحدث التغيير في حالة البروتون عند الرقم الهيدروجيني 4.07. [10] هذا الشكل الذي يحتوي على كل من الكربوكسيل الذي يفتقر إلى البروتونات هو السائد في نطاق الأس الهيدروجيني الفسيولوجي (7.35-7.45).

عند درجة حموضة أعلى ، تفقد المجموعة الأمينية البروتون الإضافي ، والأنواع السائدة هي الأنيون السالب المضاعف - OOC − CH (NH
2 ) - (CH
2 )2−COO -. يحدث التغيير في حالة البروتون عند الرقم الهيدروجيني 9.47. [10]

تحرير التماثل البصري

على الرغم من أنها تحدث بشكل طبيعي في العديد من الأطعمة ، إلا أن مساهمات النكهة التي يقدمها حمض الجلوتاميك والأحماض الأمينية الأخرى تم تحديدها علميًا فقط في أوائل القرن العشرين. تم اكتشاف المادة وتحديدها في عام 1866 من قبل الكيميائي الألماني كارل هاينريش ريتهاوزن ، الذي عالج جلوتين القمح (الذي سميت باسمه) بحمض الكبريتيك. [13] في عام 1908 ، حدد الباحث الياباني كيكوناي إيكيدا Kikunae Ikeda من جامعة طوكيو الإمبراطورية البلورات البنية التي تُركت بعد تبخر كمية كبيرة من مرق الكومبو على أنها حمض الجلوتاميك. هذه البلورات ، عند تذوقها ، أعادت إنتاج النكهة التي لا توصف ولكن التي لا يمكن إنكارها التي اكتشفها في العديد من الأطعمة ، وخاصة في الأعشاب البحرية. أطلق البروفيسور إيكيدا على هذه النكهة اسم أومامي. ثم حصل على براءة اختراع طريقة لإنتاج كميات كبيرة من الملح البلوري من حمض الجلوتاميك ، الجلوتامات أحادية الصوديوم. [14] [15]

تحرير التخليق الحيوي

المتفاعلات منتجات الانزيمات
الجلوتامين + ح2ا غلو + نيو هامبشاير3 GLS ، GLS2
NAcGlu + H.2ا غلو + خلات ن- سينثيز أسيتيل جلوتامات
ألفا كيتوجلوتارات + NADPH + NH4 + غلو + NADP + + H.2ا GLUD1 ، GLUD2 [16]
ألفا كيتوجلوتارات + حمض ألفا أميني غلو + حمض ألفا كيتو ناقلة أمين
1-بيرولين-5-كربوكسيلات + NAD + + H2ا غلو + NADH ALDH4A1
N- فورمينينو- L- الجلوتامات + FH4 غلو + 5-فورمينو- FH4 FTCD
NAAG غلو + NAA GCPII

تحرير التوليف الصناعي

يتم إنتاج حمض الجلوتاميك على أكبر نطاق من أي حمض أميني ، بإنتاج سنوي يقدر بحوالي 1.5 مليون طن في عام 2006. [17] تم استبدال التخليق الكيميائي بالتخمير الهوائي للسكريات والأمونيا في الخمسينيات من القرن الماضي ، مع الكائن الحي. الوتدية الجلوتاميك (المعروف أيضًا باسم Brevibacterium flavum) الأكثر استخدامًا للإنتاج. [18] يمكن تحقيق العزل والتنقية عن طريق التركيز والتبلور ، كما أنه متاح على نطاق واسع باعتباره ملح الهيدروكلوريد. [19]

تحرير التمثيل الغذائي

الجلوتامات هو مركب رئيسي في التمثيل الغذائي الخلوي. في البشر ، يتم تكسير البروتينات الغذائية عن طريق الهضم إلى أحماض أمينية ، والتي تعمل كوقود استقلابي لأدوار وظيفية أخرى في الجسم. عملية رئيسية في تحلل الأحماض الأمينية هي النقل ، حيث يتم نقل المجموعة الأمينية من حمض أميني إلى α-ketoacid ، يتم تحفيزها عادةً بواسطة ترانساميناز. يمكن تعميم التفاعل على هذا النحو:

حمض ألفا كيتو الشائع جدًا هو α-ketoglutarate ، وهو وسيط في دورة حمض الستريك. يعطي تحويل α-ketoglutarate الجلوتامات. غالبًا ما يكون منتج α-ketoacid الناتج مفيدًا أيضًا ، والذي يمكن أن يساهم كوقود أو كركيزة لمزيد من عمليات التمثيل الغذائي. الأمثلة هي كما يلي:

ألانين + ألفا كيتوجلوتارات ⇌ بيروفات + غلوتامات أسبارتات + ألفا كيتوجلوتارات ⇌ أوكسالو أسيتات + جلوتامات

يعد كل من البيروفات والأوكسالو أسيتات مكونين رئيسيين لعملية التمثيل الغذائي الخلوي ، حيث يساهمان كركائز أو وسيطة في العمليات الأساسية مثل تحلل السكر وتكوين السكر ودورة حمض الستريك.

يلعب الغلوتامات أيضًا دورًا مهمًا في التخلص من النيتروجين الزائد أو الضائع في الجسم. يخضع الغلوتامات لنزع الأمين ، وهو تفاعل مؤكسد يحفزه نازعة هيدروجين الجلوتامات ، [16] على النحو التالي:

الجلوتامات + H.2O + NADP + → α- كيتوجلوتارات + NADPH + NH3 + ح +

يتم بعد ذلك إخراج الأمونيا (مثل الأمونيوم) في الغالب على شكل يوريا ، يتم تصنيعها في الكبد. وبالتالي يمكن ربط عملية التحويل بنزع الأمين ، مما يسمح بشكل فعال بإزالة النيتروجين من المجموعات الأمينية للأحماض الأمينية ، عبر الغلوتامات كمواد وسيطة ، وأخيراً تفرز من الجسم على شكل يوريا.

الجلوتامات هو أيضًا ناقل عصبي (انظر أدناه) ، مما يجعله أحد أكثر الجزيئات وفرة في الدماغ. تستغل أورام الدماغ الخبيثة المعروفة باسم الورم الدبقي أو الورم الأرومي الدبقي هذه الظاهرة باستخدام الغلوتامات كمصدر للطاقة ، خاصة عندما تصبح هذه الأورام أكثر اعتمادًا على الغلوتامات بسبب الطفرات في الجين IDH1. [20] [21]

تحرير الناقل العصبي

الغلوتامات هو أكثر الناقلات العصبية إثارة في الجهاز العصبي للفقاريات. [22] في المشابك الكيميائية ، يتم تخزين الغلوتامات في حويصلات. تؤدي النبضات العصبية إلى إطلاق الجلوتامات من الخلية قبل المشبكية. يعمل الغلوتامات على مستقبلات مؤثرة في الأيضية ومستقبلات (G- بروتين مقترن). [22] في الخلية المقابلة بعد المشبكي ، ترتبط مستقبلات الغلوتامات ، مثل مستقبل NMDA أو مستقبل AMPA ، بالجلوتامات ويتم تنشيطها. بسبب دوره في اللدونة المشبكية ، يشارك الغلوتامات في الوظائف المعرفية مثل التعلم والذاكرة في الدماغ. [23] شكل اللدونة المعروف باسم التقوية طويلة المدى يحدث في المشابك الجلوتاماتيكية في قرن آمون والقشرة المخية الحديثة وأجزاء أخرى من الدماغ. يعمل الغلوتامات ليس فقط كجهاز إرسال من نقطة إلى نقطة ، ولكن أيضًا من خلال الحديث المتبادل التشابكي الممتد بين نقاط الاشتباك العصبي حيث يؤدي تجميع الغلوتامات المنطلق من المشبك المجاور إلى إرسال إشارات / حجم خارج المشبكي. [24] بالإضافة إلى ذلك ، يلعب الغلوتامات أدوارًا مهمة في تنظيم مخاريط النمو وتكوين المشابك أثناء نمو الدماغ كما وصفه مارك ماتسون في الأصل.

دارات إشارات الغلوتامات غير المشبكية في الدماغ تحرير

الغلوتامات خارج الخلية في ذبابة الفاكهة تم العثور على أدمغة لتنظيم تجمعات مستقبلات الغلوتامات بعد المشبكي ، من خلال عملية تنطوي على إزالة حساسية المستقبلات. [25] الجين المعبر عنه في الخلايا الدبقية ينقل بنشاط الغلوتامات إلى الفضاء خارج الخلية ، [25] بينما في مجموعة مستقبلات الغلوتامات المتكئة الثانية المتكئة النواة ، تم العثور على هذا الجين لتقليل مستويات الجلوتامات خارج الخلية. [26] وهذا يثير احتمالية أن يلعب الغلوتامات خارج الخلية دور "يشبه الغدد الصماء" كجزء من نظام استتباب أكبر.

تحرير السلائف GABA

يعمل الجلوتامات أيضًا كمقدمة لتخليق حمض جاما أمينوبوتيريك المثبط (GABA) في الخلايا العصبية GABA-ergic. يتم تحفيز هذا التفاعل عن طريق الغلوتامات ديكاربوكسيلاز (GAD) ، وهو الأكثر وفرة في المخيخ والبنكرياس. [ بحاجة لمصدر ]

متلازمة الشخص المتيبس هي اضطراب عصبي تسببه الأجسام المضادة لـ GAD ، مما يؤدي إلى انخفاض في تخليق GABA ، وبالتالي ضعف الوظيفة الحركية مثل تصلب العضلات والتشنج. نظرًا لأن البنكرياس يحتوي على GAD بكثرة ، يحدث تدمير مناعي مباشر في البنكرياس وسيصاب المرضى بداء السكري. [ بحاجة لمصدر ]

محسن النكهة تحرير

حمض الجلوتاميك ، باعتباره أحد مكونات البروتين ، موجود في الأطعمة التي تحتوي على البروتين ، ولكن لا يمكن تذوقه إلا عندما يكون موجودًا في شكل غير مرتبط. توجد كميات كبيرة من حمض الجلوتاميك الحر في مجموعة متنوعة من الأطعمة ، بما في ذلك الجبن وصلصة الصويا ، وحمض الجلوتاميك مسؤول عن أومامي ، وهو أحد الأذواق الخمسة الأساسية لحس الذوق البشري. غالبًا ما يستخدم حمض الجلوتاميك كمضافات غذائية ومحسن للنكهة على شكل ملح الصوديوم ، المعروف باسم الغلوتامات أحادية الصوديوم (MSG).

تحرير المغذيات

جميع اللحوم والدواجن والأسماك والبيض ومنتجات الألبان والكومبو هي مصادر ممتازة لحمض الجلوتاميك. تعمل بعض الأطعمة النباتية الغنية بالبروتين أيضًا كمصادر. 30٪ إلى 35٪ من الغلوتين (معظم البروتين الموجود في القمح) هو حمض الجلوتاميك. يتم استقلاب خمسة وتسعين في المائة من الجلوتامات الغذائية عن طريق الخلايا المعوية في المرور الأول. [27]

تعديل نمو النبات

Auxigro هو مستحضر لنمو النبات يحتوي على 30٪ حمض الجلوتاميك.

تحرير التحليل الطيفي بالرنين المغناطيسي النووي

فى السنوات الاخيرة، [ عندما؟ ] كان هناك الكثير من الأبحاث حول استخدام اقتران ثنائي القطب المتبقي (RDC) في التحليل الطيفي بالرنين المغناطيسي النووي (NMR). غالبًا ما يستخدم أحد مشتقات حمض الجلوتاميك ، بولي-بيتا-بنزيل-إل-جلوتامات (PBLG) ، كوسيط محاذاة للتحكم في مقياس التفاعلات ثنائية القطب التي لوحظت. [28]


المواد والأساليب

تصميم الدراسة والمشاركين

في هذه الدراسة ، قمنا بجمع 10 عينات مصل من عناصر تحكم صحية ، و 10 من HBV بدون تليف الكبد و 10 مرضى HBV إيجابيي HCC تطورت من تليف الكبد من نفس الجنس والعمر. ومن ثم ، كانت البيانات قابلة للمقارنة بين المجموعتين. تم تحليل مستقلبات المصل بواسطة الأيضات الكمية المستهدفة للتحليل التفاضلي للعثور على علامات محتملة محددة لمرضى سرطان الكبد. تم استخدام طريقة التحليل البيوكيميائي للتحليل المتعمق والتحقق. تم إجراء مصل لـ 115 حالة من الضوابط الصحية ، و 69 حالة من حالات HBV ، و 108 حالات من تليف الكبد الإيجابي HBV ، و 95 حالة من HCV ، و 294 حالة لمرضى HBV إيجابي HCC ، و 77 حالة من مرضى HCC المنتشر (سرطانات أخرى تنتقل إلى الكبد). تم التحقق من مجموعة التدريب الأولية. بعد ذلك ، تم تحليل مصل 118 من الضوابط السليمة ، و 142 حالة من مرضى سرطان الرئة ، و 150 حالة من مرضى سرطان الثدي ، و 140 حالة من مرضى سرطان القولون والمستقيم ، و 165 حالة من مرضى سرطان الكبد الإيجابي HBV كمجموعة التحقق. كان جميع مرضى الورم في المرحلة المبكرة ، دون علاج ورم خبيث إلى مواقع أخرى (باستثناء سرطان الكبد النقيلي). كانت المجموعات & # x2019 العمر والجنس في مجموعة التدريب ومجموعة التحقق من الصحة متشابهة ، باستثناء مجموعة سرطان الثدي (الجداول التكميلية 1 ، 2). تم جمع جميع عينات المصل في اليوم الأول بعد الاستشفاء ، قبل الجراحة أو العلاج ، وتم التجميد السريع عند & # x221280 & # x00B0C حتى الاستخدام. كانت معايير الاستبعاد للضوابط الصحية هي وظائف الكبد والكلى غير الطبيعية ، مع وجود تاريخ من أمراض الكبد أو أمراض جهازية أخرى. تم تشخيص جميع أنواع الأورام عن طريق علم الأمراض. تمت الموافقة على هذه الدراسة من قبل لجنة الأخلاقيات بمستشفى السرطان بجامعة تيانجين الطبية ، ووقع جميع المرضى على الموافقة المسبقة.

الأيض المستهدف

تم إذابة عينات المصل المجمدة عند 4 & # x00B0C. خذ 100 & # x03BCL من المصل إلى أنبوب Ep 1.5 مل وأضف 4 مجلدات من المستخلص المصنوع من MeOH / Acetonitrile (ACN) = (1/1 ، v / v) ، يحتوي على 0.05 ملي مولار DL- ميثيونين سلفون كمعيار داخلي. بعد الرج والخلط جيدًا ، ضع راسب البروتين عند & # x221220 & # x00B0C لمدة ساعتين. الطرد المركزي في 20000 ز عند 4 & # x00B0C لمدة 10 دقائق ، وانقل الطبقة العليا إلى أنبوب Ep جديد سعة 1.5 مل. تدور حتى تجف في الخلاء بواسطة Eppendorf Concentrator 5301 ، أضف 100 & # x03BCL ACN / H.2O (1/1 ، ت / ت) ، وإعادة التكوين عن طريق الاهتزاز. قم بالتصفية باستخدام غشاء مرشح 0.22 & # x03BCm ، ونقل العينة إلى زجاجة العينة للاختبار. كان حجم حقن العينة 10 & # x03BCL / الوقت ، مفصولة بنظام الطور السائل Agilent 1260 Infinity HPLC / PRF / 5 ، وتم اكتشافه بواسطة Agilent 6460 QQQ في Aksomics (شنغهاي ، الصين). تم إجراء التحليل على عمود أميد (3.5 & # x03BCm ، 2.1 & # x2217 150 ملم ، مياه) بدرجة حرارة عمود تبلغ 40 & # x00B0C. المرحلة المتنقلة أ عبارة عن محلول مائي يحتوي على 25 ملي مولار NH4OAc ، 25 ملي NH3ح2O والسائل B هو محلول أسيتونيتريل. تمت معايرة العمود بنسبة 90٪ سائل ب. يتم تحميل العينة على العمود الكروماتوغرافي بواسطة جهاز أخذ العينات التلقائي ثم فصلها بواسطة العمود الكروماتوغرافي بمعدل تدفق يبلغ 0.4 مل / دقيقة. وضع الكشف عن مقياس الطيف الكتلي وإعدادات حالة الكشف عن المستقلبات: اكتشافات وضع مراقبة التفاعل المتعدد (MRM) ، حدد قطبية الكشف المقابلة للمستقلب المحدد ، ووقت الاستبقاء ، وزوج الأيونات المحسن للكشف. يتم قياس بيانات الكشف عن المستقلبات باستخدام برنامج QuantAnalysis. إجراء تحليل تفاضلي على النتائج الكمية للحصول على المستقلبات المعبر عنها تفاضليًا.

التحليلات البيوكيميائية

تم تخزين عينات المصل والبلازما في & # x221280 & # x00B0C حتى مزيد من التحليل. تم الكشف عن اليوريا والكرياتينين (Cr) وحمض البوليك باستخدام محلل الكيمياء الحيوية التلقائي AU5800 (بيكمان كولتر ، الولايات المتحدة). تم الكشف عن اليوريا كما هو موصوف سابقًا (Wang et al. ، 2019). باختصار ، يتم تحلل اليوريا بواسطة اليوريا لإنتاج الأمونيا وثاني أكسيد الكربون. Ammonia and a-ketoglutarate are converted to glutamate under the catalysis of GDH. At the same time, a molar equivalent of reduced NADH is oxidized. For each molecule of urea to be hydrolyzed, two NADH molecules are oxidized. Due to the disappearance of NADH, the absorbance at 340 nm is proportional to the urea concentration in the sample. Cr was measured by enzyme colorimetry. Briefly, creatinine is catalyzed by creatininase to generate creatine, and creatine is catalyzed by creatase to generate sarcosine and urea, and then sarcosine is oxidized to generate glycine and hydrogen peroxide the red intensity of the produced quinoneimine is proportional to the concentration of Cr, and the intensity can be determined by measuring the increase in absorbance. Uric acid was determined by enzymatic colorimetry. Uricase breaks down uric acid to produce allantoin and hydrogen peroxide. In the presence of peroxidase, 4-aminopyrine generates quinoneimine dye from hydrogen peroxide. The red intensity of the produced quinoneimine is proportional to the concentration of uric acid.

Ammonia was detected by VITROS 5600 Integrated System (Ortho Clinical Diagnostics, United States) as previously described (Wang et al., 2019). Briefly, a drop of sample is deposited on the slide and then evenly distributed to the underlying layers. Water and non-protein components travel to the underlying buffered reagent layer, and ammonium ions are converted into gaseous ammonia. The semi-permeable membrane only allows ammonia gas to pass through and prevents buffer or hydroxide ions from reaching the indicator layer. After a period of time, the white background of the extended layer is used as a diffuse reflector to measure the reflection density of the dye.

زراعة الخلايا

The human HL-7702 hepatocyte cell line and human HCC cell line MHCC97H were obtained from the Liver Cancer Institute, Zhongshan Hospital, Fudan University, Shanghai, China. HepG2, PLC/PRF/5, Hep3B, A549, MCF-7, NCM460, HCT116, HCT8 cells were obtained from ATCC. HLE cell line was from the Health Science Research Resources Bank (Osaka, Japan). All the cells were maintained in high glucose DMEM supplemented with 10% fetal bovine serum (BioInd, Israel) and 50 IU penicillin/streptomycin (Invitrogen, United States) in a humidified atmosphere with 5% CO2 at 37ଌ. All cell lines were free of mycoplasma contamination and cultured for no more than 2 months.

Co-Culture Cell Models

200,000 HL-7702 and 100,000 MHCC97H + 100,000 HL-7702 cells were seeded in triplicate in 6-well plates. The next day the medium was changed by fresh DMEM with 10% dialysis fetal bovine serum, 25 mM glucose, and 2 mM glutamine. After 48 h, the medium was collected for urea detection. Falcon embedded cell culture chamber (PET track-etched membrane, 6 well formats, 0.4 μm, Corning, Cat#353090) was used for the co-culture model. 200,000 HL-7702, MHCC97H or PLC/PRF/5 were seeded in triplicate in 6-well plates (lower layer). 100,000 HL-7702 for each cell line were seeded in triplicate in the chamber (upper layer) on new 6-well plates. The next day the medium in 6-well plates and the chamber were changed by fresh DMEM with 10% dialysis fetal bovine serum, 25 mM glucose, and 2 mM glutamine, respectively. Then transfer the chamber to the six-well plate inoculated with HL-7702, MHCC97H or PLC/PRF/5 for culture. After 48 h, medium was collected for urea and ammonia detection.

Ammonia and Urea Excretion

200,000 cells were seeded in triplicate in 12-well plates. The next day the medium was changed by fresh DMEM with 10% dialysis fetal bovine serum, 25 mM glucose and 2 mM glutamine. After 8 h the medium was collected for ammonia detection. 100,000 cells were seeded in triplicate in 12-well plates. The next day the medium was changed by fresh DMEM with 10% dialysis fetal bovine serum, 25 mM glucose, and 2 mM glutamine. After 48 h, the medium was collected for urea detection. The medium without cells under the same conditions was used to measure the concentration of metabolites as the background control. Values for ammonia and urea in the experimental conditions were subtracted from the respective control media values.

Proliferation Assays

20,000 cells were seeded in triplicate in 24-well plates, and changed to the conditioned medium the next day. After 3 days, wells were washed twice with PBS buffer to remove dead cells, and then the cells were trypsinized cell number was determined using a hemocytometer. For each well, the fold change in cell number relative to Day0 was calculated.

Colony Formation Assay

Colony formation assays were performed to assess the effects of NH4Cl on cell proliferation. 1000 cells were seeded in triplicate in 12-well plates, change to 2 ml of culture medium containing 0� mM of NH4Cl the next day. After incubating at 37ଌ for 2 weeks, cells were stained with 0.5% crystal violet for 5 min, and colonies were counted with Image J.

Western Blot

After desired treatments as specified as indicated, cells were washed twice with PBS and lysed in buffer on ice (20 mM Tris–HCl, pH 7.5, 150mM NaCl, 1 mM EDTA, 1% Triton X-100, 2.5 mM sodium pyrophosphate, 1mM β-glycer-ophosphate, 1mM sodium vanadate, 1mgml-1 leupeptin, 1mM phenylmethyl-sulfonylfluoride). Equal amounts of protein (30 μg) were loaded onto 10% SDS–PAGE gels. Western detection was carried out using a Li-Cor Odyssey image reader (Li-Cor, United States). The goat anti-rabbit IgG (Cat#C30502-01) and goat anti-mouse IgG (Cat#C30509-01) secondary antibodies were obtained from Li-Cor (United States). The final concentration of the secondary antibodies used was 0.1 μg/ml (1:10000 dilution). The primary antibodies against β-Actin (Cat#60008-1, 1:5000 dilution), GAPDH (Cat#60004-1-Ig, 1:5000 dilution), FLAG Tag (Cat#80010-1-RR, 1:3000 dilution), α-Tubulin (Cat#11224-1-AP, 1:5000 dilution), CPS1 (Cat#18703-1-AP, 1:1000 dilution), OTC (Cat#26470-1-AP, 1:1000 dilution), ARG1 (Cat#16001-1-AP, 1:1000), GDH1 (Cat#14299-1-AP, 1:1000 dilution), and GS (Cat#11037-2-AP, 1:1000 dilution) were purchased from Proteintech (United States), The primary antibodies against CAD (Cat#sc-376072, Santa Cruz, United States) and p-CAD (Ser1859) (Cat#70307, Cell Signaling Technology, United States) were used with a dilution of 1:1000.

Gene Construction and Lentivirus Production

The pLKO.1 lentiviral RNAi expression system was used to construct lentiviral shRNA for genes. The sequences of shRNA used in this study included the following: shScramble: CCTAAGGTTAAGTCGCCCTCG, shCPS1-#1: CCAGAAATTAAGAACGTCGTA, shCPS1-#2: CGTACTTCAATCAATGTTGTT. pCDH-FLAG-CPS1 plasmid was kindly gifted by Professor Peng Jiang at Tsinghua University. Viral packaging was done according to the protocol: expression plasmids pCDH-CMV-cDNA, pCMV-dR8.91, and pCMV-VSV-G were co-transfected into 293T cells using the Polyethylenimine (PEI) coprecipitation at 20:10:10 μg (for a 10-cm dish). After incubation for 6 h, the medium containing PEI and plasmid mixture was replaced with complete fresh medium. Media containing virus was collected 48 h after transfection and then filter the culture medium with a 0.2 μm filter (Merck Millipore Ltd., IRELAND). The culture medium with the virus was stored at �ଌ for use. Cancer cells were infected with the viruses in the presence of polybrene (10 μgml 𠄱 ) for 8 h, the medium was replaced with complete fresh medium for 40 h, and then cells were selected with puromycin, generating stable CPS1 knockdown or over-expression cell lines.

تحليل احصائي

Quantitative data was expressed as data plots non-normally distributed data was expressed as median (25% Percentile, 75% Percentile), and normally distributed data was expressed as mean ± SD. Differences between two independent groups were compared with the Mann-Whitney U test. One-way ANOVA followed by Tukey’s multiple comparison tests were used for multi comparisons. The two-tailed value of ص < 0.05 is statistically significant. GraphPad Prism 8.0 software was adopted to analyze the above data. MedCalc software was used to draw ROC curves of different indicators. The 95% confidence interval for comparing the Area Under Curve (AUC) and ص-values of related ROC curves were obtained by the method described by DeLong et al. (1988).


نتائج ومناقشة

Comparative Analysis of CPS1 and OTC Surface Residues Whose Mutations Disrupt Ureagenesis and Cause Disease

More than half of CPS1 and OTC deficiency cases are caused by missense mutations (Haberle et al., 2011 Caldovic et al., 2015). Due to the tight channeling of CPS1 and OTC intermediates in the mitochondria (Cohen et al., 1992) we reasoned that some of the disease-causing missense variants of CPS1 and OTC might disrupt their interaction and used the following protocol to assess this possibility (Supplementary Figure S1). First, we compiled published reports of CPS1 and OTC missense mutations found in patients with clinical and biochemical symptoms of CPS1 and OTC deficiencies. Next, we calculated relative solvent accessible surface area (SASA) of CPS1 and OTC amino acids and mapped the positions of amino acids whose replacements cause CPS1 and OTC deficiencies. Mutations of surface amino acids, with relative SASA greater than 25% and known effects on the biochemical function of mutant CPS1 and OTC were not analyzed further. For mutations of surface residues whose effect on biochemical function of CPS1 and OTC has not been established, we calculated the effect of amino acid replacements on protein stability (Supplementary Figure S1). Similar analysis of NAGS missense variants could not be carried out as full-length NAGS crystal structure has not been determined. Only the acetyltransferase domain of human NAGS has been crystallized (Zhao et al., 2013), which is insufficient to build a homology model that accurately represents the NAGS quaternary structure.

Human CPS1 pre-protein is 1,500 amino acids long 1,352 and 1,422 amino acids are visible in the apo and liganded state, respectively (de Cima et al., 2015). Of these, 556 and 525 amino acids have more than 25% of their surface area exposed to solvent in the apo and liganded states, respectively, which we refer to as surface residues/amino acids (Levy, 2010). Of the 161 missense mutations that cause CPS1 deficiency (Supplementary Table S1), 22 mutations affect residues that are on the surface of both apo and liganded CPS1, 18 affect surface residues of the apo CPS1, and three affect surface residues of the liganded CPS1 (Supplementary Table S2). Biochemical properties of the p.Y389C, p.A438T, p.T471N, p.R721Q, p.K875E, p.E1255D, p.R1262Q, p.R1262P, p.C1327R, p.R1371L, p.P1439L, p.T1443A, and p.Y1491H recombinant CPS1 revealed that mutations of these surface residues result in destabilization, decreased enzymatic activity, and/or decreased affinity for NAG (Pekkala et al., 2009 Diez-Fernandez et al., 2013, 2014, 2015 Supplementary Table S2). The p.R1317W and p.G1333E replacements affect amino acids in the T’-loop and may disrupt substrate channeling between CPS1 active sites (de Cima et al., 2015), while replacement of the A438 with proline could affect flexibility of and hydrogen bonding within the T-loop (de Cima et al., 2015 Gao et al., 2015). To gain insight into effects of amino acid replacements on mutant CPS1 that were not characterized experimentally we modeled impact of 27 amino acid substitutions on CPS1 structure and calculated their effects on protein stability (Supplementary Table S2). Predicted stability of 15 mutant CPS1 proteins affecting 14 residues was either similar or higher than stability of the wild-type CPS1 (Supplementary Table S2). Replacements of these surface residues, distant to active and substrate binding sites, that do not destabilize the protein, qualify as mutations that could affect clustering of urea cycle enzymes by disrupting protein-protein interactions with OTC and/or NAGS (Figure 1 and Supplementary Table S2). Functional importance of the 14 surface amino acids whose replacements cause CPS1 deficiency was evaluated by determining their conservation in CPS1 homologs from 233 animal species (Supplementary File S2 and Supplementary Table S3). Eight of these residues are 100% conserved, and additional five are over 85% conserved in CPS1 homologs, while residues that correspond to less conserved H1045 and R1228 have similar size and/or chemical properties in most species (Table 1 and Supplementary Figure S2).

شكل 1. Surface residues in the apo (أ) and liganded CPS1 (ب) whose replacements cause CPS1 deficiency. Disease causing mutations in the CPS1 gene were mapped to 3-dimensional structures of the apo CPS1 (5DOT) and liganded CPS1 (5DOU) enzymes. Surface residues in the apo and liganded CPS1 are shown in magenta. CPS1 glutaminase domain is shown in light gray, synthetase domain is shown in dark gray and the linker connecting the two domains is shown in yellow.


قم بتنزيل وطباعة هذه المقالة لاستخداماتك العلمية والبحثية والتعليمية الشخصية.

شراء عدد واحد من علم مقابل 15 دولارًا أمريكيًا فقط.

علم

Vol 342, Issue 6158
01 November 2013

أدوات المادة

الرجاء تسجيل الدخول لإضافة تنبيه لهذه المقالة.

By Clara Bien Peek , Alison H. Affinati , Kathryn Moynihan Ramsey , Hsin-Yu Kuo , Wei Yu , Laura A. Sena , Olga Ilkayeva , Biliana Marcheva , Yumiko Kobayashi , Chiaki Omura , Daniel C. Levine , David J. Bacsik , David Gius , Christopher B. Newgard , Eric Goetzman , Navdeep S. Chandel , John M. Denu , Milan Mrksich , Joseph Bass

The coenzyme nicotinamide adenine dinucleotide mechanistically links the circadian clock to control of energy production by mitochondria. [Also see Perspective by Rey and Reddy]


7.5: Urea Cycle - Biology

a Department of Nutrition and Food Science, Faculty of Biology, University of Barcelona, Av. Diagonal 643, 08028 Barcelona, Spain
بريد الالكتروني: [email protected]

b Institute of Biomedicine, University of Barcelona, 08028 Barcelona, Spain

c CIBER-OBN Research Web, Barcelona, Spain

الملخص

White adipose tissue (WAT) contains a powerful metabolic machinery related to energy metabolism and partition. The adaptive, regulatory, size and structural variety of WAT agrees with this control role. However, its nitrogen metabolism has been sparsely studied and we know close to nothing about its implication on N-related processes and homoeostasis. We have studied, and found a complete urea cycle (liver type) in four WAT sites (gene expressions and enzyme activities). We postulated a possible function of the cycle (under basal conditions) in the control of arginine handling through citrulline synthesis. In our opinion, the metabolic and control potential of WAT on energy metabolism may be second only to liver. This impression should be extended to amino acid metabolism too, WAT providing an extra-intestinal source of citrulline to maintain the body availability of arginine independently of the operation of intestine–liver urea cycle for N disposal.


Reimbursement Scenario in Urea Cycle Disorders

Approaching reimbursement proactively can have a positive impact both during the late stages of product development and well after product launch. In a report, we take reimbursement into consideration to identify economically attractive indications and market opportunities. When working with finite resources, the ability to select the markets with the fewest reimbursement barriers can be a critical business and price strategy.


الانتماءات

Department of Biochemistry, University of Texas Southwestern Medical Center, Dallas, Texas, USA

Jun Chen, Benjamin M Sutter, Lei Shi & Benjamin P Tu

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

مساهمات

J.C., L.S., B.M.S., and B.P.T. تصور وتصميم الدراسة. J.C., B.M.S., and L.S. conducted the experiments. L.S. first observed the ability of aspartate to rescue growth of GATOR1 (SEACIT) mutants. J.C. and B.P.T. wrote the manuscript.

المؤلف المراسل


شاهد الفيديو: UREA CYCLE شرح بالعربي (أغسطس 2022).